ID: 1159183352

View in Genome Browser
Species Human (GRCh38)
Location 18:64939486-64939508
Sequence CTTTAAACACGAATGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159183344_1159183352 13 Left 1159183344 18:64939450-64939472 CCCCCTTCATTGGGATGTGGGTT No data
Right 1159183352 18:64939486-64939508 CTTTAAACACGAATGAGGCTGGG No data
1159183345_1159183352 12 Left 1159183345 18:64939451-64939473 CCCCTTCATTGGGATGTGGGTTA No data
Right 1159183352 18:64939486-64939508 CTTTAAACACGAATGAGGCTGGG No data
1159183347_1159183352 10 Left 1159183347 18:64939453-64939475 CCTTCATTGGGATGTGGGTTAGA No data
Right 1159183352 18:64939486-64939508 CTTTAAACACGAATGAGGCTGGG No data
1159183346_1159183352 11 Left 1159183346 18:64939452-64939474 CCCTTCATTGGGATGTGGGTTAG No data
Right 1159183352 18:64939486-64939508 CTTTAAACACGAATGAGGCTGGG No data
1159183341_1159183352 16 Left 1159183341 18:64939447-64939469 CCTCCCCCTTCATTGGGATGTGG No data
Right 1159183352 18:64939486-64939508 CTTTAAACACGAATGAGGCTGGG No data
1159183340_1159183352 21 Left 1159183340 18:64939442-64939464 CCTCTCCTCCCCCTTCATTGGGA No data
Right 1159183352 18:64939486-64939508 CTTTAAACACGAATGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159183352 Original CRISPR CTTTAAACACGAATGAGGCT GGG Intergenic
No off target data available for this crispr