ID: 1159190423 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:65034781-65034803 |
Sequence | ATCACTGCCACTCTAAAAGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1159190423_1159190429 | 30 | Left | 1159190423 | 18:65034781-65034803 | CCCCCTTTTAGAGTGGCAGTGAT | No data | ||
Right | 1159190429 | 18:65034834-65034856 | AAGCAGAACTAAAAAACCTTGGG | No data | ||||
1159190423_1159190428 | 29 | Left | 1159190423 | 18:65034781-65034803 | CCCCCTTTTAGAGTGGCAGTGAT | No data | ||
Right | 1159190428 | 18:65034833-65034855 | TAAGCAGAACTAAAAAACCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1159190423 | Original CRISPR | ATCACTGCCACTCTAAAAGG GGG (reversed) | Intergenic | ||