ID: 1159190423 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:65034781-65034803 |
| Sequence | ATCACTGCCACTCTAAAAGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1159190423_1159190428 | 29 | Left | 1159190423 | 18:65034781-65034803 | CCCCCTTTTAGAGTGGCAGTGAT | No data | ||
| Right | 1159190428 | 18:65034833-65034855 | TAAGCAGAACTAAAAAACCTTGG | No data | ||||
| 1159190423_1159190429 | 30 | Left | 1159190423 | 18:65034781-65034803 | CCCCCTTTTAGAGTGGCAGTGAT | No data | ||
| Right | 1159190429 | 18:65034834-65034856 | AAGCAGAACTAAAAAACCTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1159190423 | Original CRISPR | ATCACTGCCACTCTAAAAGG GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||