ID: 1159190423

View in Genome Browser
Species Human (GRCh38)
Location 18:65034781-65034803
Sequence ATCACTGCCACTCTAAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159190423_1159190428 29 Left 1159190423 18:65034781-65034803 CCCCCTTTTAGAGTGGCAGTGAT No data
Right 1159190428 18:65034833-65034855 TAAGCAGAACTAAAAAACCTTGG No data
1159190423_1159190429 30 Left 1159190423 18:65034781-65034803 CCCCCTTTTAGAGTGGCAGTGAT No data
Right 1159190429 18:65034834-65034856 AAGCAGAACTAAAAAACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159190423 Original CRISPR ATCACTGCCACTCTAAAAGG GGG (reversed) Intergenic
No off target data available for this crispr