ID: 1159190424

View in Genome Browser
Species Human (GRCh38)
Location 18:65034782-65034804
Sequence GATCACTGCCACTCTAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159190424_1159190429 29 Left 1159190424 18:65034782-65034804 CCCCTTTTAGAGTGGCAGTGATC No data
Right 1159190429 18:65034834-65034856 AAGCAGAACTAAAAAACCTTGGG No data
1159190424_1159190428 28 Left 1159190424 18:65034782-65034804 CCCCTTTTAGAGTGGCAGTGATC No data
Right 1159190428 18:65034833-65034855 TAAGCAGAACTAAAAAACCTTGG No data
1159190424_1159190430 30 Left 1159190424 18:65034782-65034804 CCCCTTTTAGAGTGGCAGTGATC No data
Right 1159190430 18:65034835-65034857 AGCAGAACTAAAAAACCTTGGGG 0: 1
1: 0
2: 2
3: 20
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159190424 Original CRISPR GATCACTGCCACTCTAAAAG GGG (reversed) Intergenic