ID: 1159190424 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:65034782-65034804 |
Sequence | GATCACTGCCACTCTAAAAG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1159190424_1159190429 | 29 | Left | 1159190424 | 18:65034782-65034804 | CCCCTTTTAGAGTGGCAGTGATC | No data | ||
Right | 1159190429 | 18:65034834-65034856 | AAGCAGAACTAAAAAACCTTGGG | No data | ||||
1159190424_1159190428 | 28 | Left | 1159190424 | 18:65034782-65034804 | CCCCTTTTAGAGTGGCAGTGATC | No data | ||
Right | 1159190428 | 18:65034833-65034855 | TAAGCAGAACTAAAAAACCTTGG | No data | ||||
1159190424_1159190430 | 30 | Left | 1159190424 | 18:65034782-65034804 | CCCCTTTTAGAGTGGCAGTGATC | No data | ||
Right | 1159190430 | 18:65034835-65034857 | AGCAGAACTAAAAAACCTTGGGG | 0: 1 1: 0 2: 2 3: 20 4: 295 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1159190424 | Original CRISPR | GATCACTGCCACTCTAAAAG GGG (reversed) | Intergenic | ||