ID: 1159190428

View in Genome Browser
Species Human (GRCh38)
Location 18:65034833-65034855
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159190423_1159190428 29 Left 1159190423 18:65034781-65034803 CCCCCTTTTAGAGTGGCAGTGAT No data
Right 1159190428 18:65034833-65034855 TAAGCAGAACTAAAAAACCTTGG No data
1159190425_1159190428 27 Left 1159190425 18:65034783-65034805 CCCTTTTAGAGTGGCAGTGATCT No data
Right 1159190428 18:65034833-65034855 TAAGCAGAACTAAAAAACCTTGG No data
1159190426_1159190428 26 Left 1159190426 18:65034784-65034806 CCTTTTAGAGTGGCAGTGATCTT No data
Right 1159190428 18:65034833-65034855 TAAGCAGAACTAAAAAACCTTGG No data
1159190424_1159190428 28 Left 1159190424 18:65034782-65034804 CCCCTTTTAGAGTGGCAGTGATC No data
Right 1159190428 18:65034833-65034855 TAAGCAGAACTAAAAAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159190428 Original CRISPR TAAGCAGAACTAAAAAACCT TGG Intergenic
No off target data available for this crispr