ID: 1159194885

View in Genome Browser
Species Human (GRCh38)
Location 18:65100640-65100662
Sequence CTGTTATTCTTTAGGTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159194885_1159194889 28 Left 1159194885 18:65100640-65100662 CCATGTGACCTAAAGAATAACAG No data
Right 1159194889 18:65100691-65100713 AAATTAGTTAATGCATATAATGG 0: 2
1: 0
2: 13
3: 132
4: 649
1159194885_1159194890 29 Left 1159194885 18:65100640-65100662 CCATGTGACCTAAAGAATAACAG No data
Right 1159194890 18:65100692-65100714 AATTAGTTAATGCATATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159194885 Original CRISPR CTGTTATTCTTTAGGTCACA TGG (reversed) Intergenic
No off target data available for this crispr