ID: 1159196434

View in Genome Browser
Species Human (GRCh38)
Location 18:65122344-65122366
Sequence ATGGTTAAACAGCCAAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159196428_1159196434 6 Left 1159196428 18:65122315-65122337 CCTGTGTTCCAACTTCTTCAATT No data
Right 1159196434 18:65122344-65122366 ATGGTTAAACAGCCAAGGCATGG No data
1159196429_1159196434 -2 Left 1159196429 18:65122323-65122345 CCAACTTCTTCAATTCCAGCCAT No data
Right 1159196434 18:65122344-65122366 ATGGTTAAACAGCCAAGGCATGG No data
1159196427_1159196434 22 Left 1159196427 18:65122299-65122321 CCTCAGGACATGGTGTCCTGTGT No data
Right 1159196434 18:65122344-65122366 ATGGTTAAACAGCCAAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159196434 Original CRISPR ATGGTTAAACAGCCAAGGCA TGG Intergenic
No off target data available for this crispr