ID: 1159206490

View in Genome Browser
Species Human (GRCh38)
Location 18:65259734-65259756
Sequence CAGAGCCATTACATTTAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159206487_1159206490 27 Left 1159206487 18:65259684-65259706 CCTGATACTTCTCATTTATTTTC No data
Right 1159206490 18:65259734-65259756 CAGAGCCATTACATTTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159206490 Original CRISPR CAGAGCCATTACATTTAAAC TGG Intergenic
No off target data available for this crispr