ID: 1159206927

View in Genome Browser
Species Human (GRCh38)
Location 18:65265154-65265176
Sequence CTTTGTGAGGCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270574
Summary {0: 8, 1: 1404, 2: 26762, 3: 81732, 4: 160668}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159206927_1159206933 -8 Left 1159206927 18:65265154-65265176 CCATCCACCTTGGCCTCACAAAG 0: 8
1: 1404
2: 26762
3: 81732
4: 160668
Right 1159206933 18:65265169-65265191 TCACAAAGTGCTGGGATTACAGG 0: 1786
1: 298626
2: 265319
3: 148850
4: 129231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159206927 Original CRISPR CTTTGTGAGGCCAAGGTGGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr