ID: 1159208802

View in Genome Browser
Species Human (GRCh38)
Location 18:65288271-65288293
Sequence ATCAAATCCTAGGAGAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159208802_1159208809 29 Left 1159208802 18:65288271-65288293 CCTTAATTCTCCTAGGATTTGAT No data
Right 1159208809 18:65288323-65288345 CATTCATATTTATTTCTTGAAGG No data
1159208802_1159208808 4 Left 1159208802 18:65288271-65288293 CCTTAATTCTCCTAGGATTTGAT No data
Right 1159208808 18:65288298-65288320 TGCAACAGGAGGCTGGGTAAAGG No data
1159208802_1159208807 -2 Left 1159208802 18:65288271-65288293 CCTTAATTCTCCTAGGATTTGAT No data
Right 1159208807 18:65288292-65288314 ATATCTTGCAACAGGAGGCTGGG No data
1159208802_1159208806 -3 Left 1159208802 18:65288271-65288293 CCTTAATTCTCCTAGGATTTGAT No data
Right 1159208806 18:65288291-65288313 GATATCTTGCAACAGGAGGCTGG No data
1159208802_1159208804 -10 Left 1159208802 18:65288271-65288293 CCTTAATTCTCCTAGGATTTGAT No data
Right 1159208804 18:65288284-65288306 AGGATTTGATATCTTGCAACAGG No data
1159208802_1159208805 -7 Left 1159208802 18:65288271-65288293 CCTTAATTCTCCTAGGATTTGAT No data
Right 1159208805 18:65288287-65288309 ATTTGATATCTTGCAACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159208802 Original CRISPR ATCAAATCCTAGGAGAATTA AGG (reversed) Intergenic
No off target data available for this crispr