ID: 1159216090

View in Genome Browser
Species Human (GRCh38)
Location 18:65392600-65392622
Sequence ACAACATGTCAGTTTCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159216090_1159216091 -9 Left 1159216090 18:65392600-65392622 CCAGCTTGAAACTGACATGTTGT No data
Right 1159216091 18:65392614-65392636 ACATGTTGTGATTATTTTGAAGG No data
1159216090_1159216092 -4 Left 1159216090 18:65392600-65392622 CCAGCTTGAAACTGACATGTTGT No data
Right 1159216092 18:65392619-65392641 TTGTGATTATTTTGAAGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159216090 Original CRISPR ACAACATGTCAGTTTCAAGC TGG (reversed) Intergenic
No off target data available for this crispr