ID: 1159216852

View in Genome Browser
Species Human (GRCh38)
Location 18:65403456-65403478
Sequence CAAGCTGGATACTTTCATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159216847_1159216852 29 Left 1159216847 18:65403404-65403426 CCTATTAGGCACTAGAGCTAGAG No data
Right 1159216852 18:65403456-65403478 CAAGCTGGATACTTTCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159216852 Original CRISPR CAAGCTGGATACTTTCATTG GGG Intergenic
No off target data available for this crispr