ID: 1159218462

View in Genome Browser
Species Human (GRCh38)
Location 18:65428342-65428364
Sequence TGAGGCTGCAGCAGAGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159218462_1159218471 29 Left 1159218462 18:65428342-65428364 CCCGCTGCTCTGCTGCAGCCTCA No data
Right 1159218471 18:65428394-65428416 GCTCTTGCAATGGCTAAGTGGGG No data
1159218462_1159218467 19 Left 1159218462 18:65428342-65428364 CCCGCTGCTCTGCTGCAGCCTCA No data
Right 1159218467 18:65428384-65428406 ATCTGCTCCAGCTCTTGCAATGG No data
1159218462_1159218469 27 Left 1159218462 18:65428342-65428364 CCCGCTGCTCTGCTGCAGCCTCA No data
Right 1159218469 18:65428392-65428414 CAGCTCTTGCAATGGCTAAGTGG No data
1159218462_1159218470 28 Left 1159218462 18:65428342-65428364 CCCGCTGCTCTGCTGCAGCCTCA No data
Right 1159218470 18:65428393-65428415 AGCTCTTGCAATGGCTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159218462 Original CRISPR TGAGGCTGCAGCAGAGCAGC GGG (reversed) Intergenic