ID: 1159218463

View in Genome Browser
Species Human (GRCh38)
Location 18:65428343-65428365
Sequence ATGAGGCTGCAGCAGAGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159218463_1159218470 27 Left 1159218463 18:65428343-65428365 CCGCTGCTCTGCTGCAGCCTCAT No data
Right 1159218470 18:65428393-65428415 AGCTCTTGCAATGGCTAAGTGGG No data
1159218463_1159218471 28 Left 1159218463 18:65428343-65428365 CCGCTGCTCTGCTGCAGCCTCAT No data
Right 1159218471 18:65428394-65428416 GCTCTTGCAATGGCTAAGTGGGG No data
1159218463_1159218467 18 Left 1159218463 18:65428343-65428365 CCGCTGCTCTGCTGCAGCCTCAT No data
Right 1159218467 18:65428384-65428406 ATCTGCTCCAGCTCTTGCAATGG No data
1159218463_1159218469 26 Left 1159218463 18:65428343-65428365 CCGCTGCTCTGCTGCAGCCTCAT No data
Right 1159218469 18:65428392-65428414 CAGCTCTTGCAATGGCTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159218463 Original CRISPR ATGAGGCTGCAGCAGAGCAG CGG (reversed) Intergenic