ID: 1159218465

View in Genome Browser
Species Human (GRCh38)
Location 18:65428374-65428396
Sequence AGCTGGAGCAGATAAGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159218465_1159218471 -3 Left 1159218465 18:65428374-65428396 CCCACATCTTATCTGCTCCAGCT No data
Right 1159218471 18:65428394-65428416 GCTCTTGCAATGGCTAAGTGGGG No data
1159218465_1159218475 26 Left 1159218465 18:65428374-65428396 CCCACATCTTATCTGCTCCAGCT No data
Right 1159218475 18:65428423-65428445 TACAACTCTGGCTGCCACTCTGG No data
1159218465_1159218477 30 Left 1159218465 18:65428374-65428396 CCCACATCTTATCTGCTCCAGCT No data
Right 1159218477 18:65428427-65428449 ACTCTGGCTGCCACTCTGGAGGG No data
1159218465_1159218476 29 Left 1159218465 18:65428374-65428396 CCCACATCTTATCTGCTCCAGCT No data
Right 1159218476 18:65428426-65428448 AACTCTGGCTGCCACTCTGGAGG No data
1159218465_1159218472 14 Left 1159218465 18:65428374-65428396 CCCACATCTTATCTGCTCCAGCT No data
Right 1159218472 18:65428411-65428433 GTGGGGCCCAAGTACAACTCTGG No data
1159218465_1159218469 -5 Left 1159218465 18:65428374-65428396 CCCACATCTTATCTGCTCCAGCT No data
Right 1159218469 18:65428392-65428414 CAGCTCTTGCAATGGCTAAGTGG No data
1159218465_1159218470 -4 Left 1159218465 18:65428374-65428396 CCCACATCTTATCTGCTCCAGCT No data
Right 1159218470 18:65428393-65428415 AGCTCTTGCAATGGCTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159218465 Original CRISPR AGCTGGAGCAGATAAGATGT GGG (reversed) Intergenic