ID: 1159218466

View in Genome Browser
Species Human (GRCh38)
Location 18:65428375-65428397
Sequence GAGCTGGAGCAGATAAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159218466_1159218469 -6 Left 1159218466 18:65428375-65428397 CCACATCTTATCTGCTCCAGCTC No data
Right 1159218469 18:65428392-65428414 CAGCTCTTGCAATGGCTAAGTGG No data
1159218466_1159218476 28 Left 1159218466 18:65428375-65428397 CCACATCTTATCTGCTCCAGCTC No data
Right 1159218476 18:65428426-65428448 AACTCTGGCTGCCACTCTGGAGG No data
1159218466_1159218472 13 Left 1159218466 18:65428375-65428397 CCACATCTTATCTGCTCCAGCTC No data
Right 1159218472 18:65428411-65428433 GTGGGGCCCAAGTACAACTCTGG No data
1159218466_1159218470 -5 Left 1159218466 18:65428375-65428397 CCACATCTTATCTGCTCCAGCTC No data
Right 1159218470 18:65428393-65428415 AGCTCTTGCAATGGCTAAGTGGG No data
1159218466_1159218477 29 Left 1159218466 18:65428375-65428397 CCACATCTTATCTGCTCCAGCTC No data
Right 1159218477 18:65428427-65428449 ACTCTGGCTGCCACTCTGGAGGG No data
1159218466_1159218475 25 Left 1159218466 18:65428375-65428397 CCACATCTTATCTGCTCCAGCTC No data
Right 1159218475 18:65428423-65428445 TACAACTCTGGCTGCCACTCTGG No data
1159218466_1159218471 -4 Left 1159218466 18:65428375-65428397 CCACATCTTATCTGCTCCAGCTC No data
Right 1159218471 18:65428394-65428416 GCTCTTGCAATGGCTAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159218466 Original CRISPR GAGCTGGAGCAGATAAGATG TGG (reversed) Intergenic
No off target data available for this crispr