ID: 1159218470

View in Genome Browser
Species Human (GRCh38)
Location 18:65428393-65428415
Sequence AGCTCTTGCAATGGCTAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159218463_1159218470 27 Left 1159218463 18:65428343-65428365 CCGCTGCTCTGCTGCAGCCTCAT No data
Right 1159218470 18:65428393-65428415 AGCTCTTGCAATGGCTAAGTGGG No data
1159218464_1159218470 10 Left 1159218464 18:65428360-65428382 CCTCATGACAGCTTCCCACATCT No data
Right 1159218470 18:65428393-65428415 AGCTCTTGCAATGGCTAAGTGGG No data
1159218465_1159218470 -4 Left 1159218465 18:65428374-65428396 CCCACATCTTATCTGCTCCAGCT No data
Right 1159218470 18:65428393-65428415 AGCTCTTGCAATGGCTAAGTGGG No data
1159218462_1159218470 28 Left 1159218462 18:65428342-65428364 CCCGCTGCTCTGCTGCAGCCTCA No data
Right 1159218470 18:65428393-65428415 AGCTCTTGCAATGGCTAAGTGGG No data
1159218466_1159218470 -5 Left 1159218466 18:65428375-65428397 CCACATCTTATCTGCTCCAGCTC No data
Right 1159218470 18:65428393-65428415 AGCTCTTGCAATGGCTAAGTGGG No data
1159218461_1159218470 29 Left 1159218461 18:65428341-65428363 CCCCGCTGCTCTGCTGCAGCCTC No data
Right 1159218470 18:65428393-65428415 AGCTCTTGCAATGGCTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159218470 Original CRISPR AGCTCTTGCAATGGCTAAGT GGG Intergenic