ID: 1159218472

View in Genome Browser
Species Human (GRCh38)
Location 18:65428411-65428433
Sequence GTGGGGCCCAAGTACAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159218468_1159218472 -3 Left 1159218468 18:65428391-65428413 CCAGCTCTTGCAATGGCTAAGTG No data
Right 1159218472 18:65428411-65428433 GTGGGGCCCAAGTACAACTCTGG No data
1159218466_1159218472 13 Left 1159218466 18:65428375-65428397 CCACATCTTATCTGCTCCAGCTC No data
Right 1159218472 18:65428411-65428433 GTGGGGCCCAAGTACAACTCTGG No data
1159218464_1159218472 28 Left 1159218464 18:65428360-65428382 CCTCATGACAGCTTCCCACATCT No data
Right 1159218472 18:65428411-65428433 GTGGGGCCCAAGTACAACTCTGG No data
1159218465_1159218472 14 Left 1159218465 18:65428374-65428396 CCCACATCTTATCTGCTCCAGCT No data
Right 1159218472 18:65428411-65428433 GTGGGGCCCAAGTACAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159218472 Original CRISPR GTGGGGCCCAAGTACAACTC TGG Intergenic