ID: 1159218476

View in Genome Browser
Species Human (GRCh38)
Location 18:65428426-65428448
Sequence AACTCTGGCTGCCACTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159218468_1159218476 12 Left 1159218468 18:65428391-65428413 CCAGCTCTTGCAATGGCTAAGTG No data
Right 1159218476 18:65428426-65428448 AACTCTGGCTGCCACTCTGGAGG No data
1159218466_1159218476 28 Left 1159218466 18:65428375-65428397 CCACATCTTATCTGCTCCAGCTC No data
Right 1159218476 18:65428426-65428448 AACTCTGGCTGCCACTCTGGAGG No data
1159218465_1159218476 29 Left 1159218465 18:65428374-65428396 CCCACATCTTATCTGCTCCAGCT No data
Right 1159218476 18:65428426-65428448 AACTCTGGCTGCCACTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159218476 Original CRISPR AACTCTGGCTGCCACTCTGG AGG Intergenic