ID: 1159219267

View in Genome Browser
Species Human (GRCh38)
Location 18:65438646-65438668
Sequence ATGCTCTTACAGGAGGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159219267_1159219270 6 Left 1159219267 18:65438646-65438668 CCTTGTGCCTCCTGTAAGAGCAT No data
Right 1159219270 18:65438675-65438697 GATCTTAAATCCCTGAATACAGG No data
1159219267_1159219271 7 Left 1159219267 18:65438646-65438668 CCTTGTGCCTCCTGTAAGAGCAT No data
Right 1159219271 18:65438676-65438698 ATCTTAAATCCCTGAATACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159219267 Original CRISPR ATGCTCTTACAGGAGGCACA AGG (reversed) Intergenic
No off target data available for this crispr