ID: 1159222914

View in Genome Browser
Species Human (GRCh38)
Location 18:65488612-65488634
Sequence CAATGTATCACACTCCCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159222914_1159222920 15 Left 1159222914 18:65488612-65488634 CCACGTGGGAGTGTGATACATTG No data
Right 1159222920 18:65488650-65488672 CTGCCACTGAAAGTGTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159222914 Original CRISPR CAATGTATCACACTCCCACG TGG (reversed) Intergenic
No off target data available for this crispr