ID: 1159225077

View in Genome Browser
Species Human (GRCh38)
Location 18:65523189-65523211
Sequence CTGTGCTTGAAGAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159225068_1159225077 26 Left 1159225068 18:65523140-65523162 CCCACAACTCCAGGAAGCACAGC No data
Right 1159225077 18:65523189-65523211 CTGTGCTTGAAGAGAGAAGAGGG No data
1159225069_1159225077 25 Left 1159225069 18:65523141-65523163 CCACAACTCCAGGAAGCACAGCT No data
Right 1159225077 18:65523189-65523211 CTGTGCTTGAAGAGAGAAGAGGG No data
1159225070_1159225077 17 Left 1159225070 18:65523149-65523171 CCAGGAAGCACAGCTCGCAGCTC No data
Right 1159225077 18:65523189-65523211 CTGTGCTTGAAGAGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159225077 Original CRISPR CTGTGCTTGAAGAGAGAAGA GGG Intergenic
No off target data available for this crispr