ID: 1159234452

View in Genome Browser
Species Human (GRCh38)
Location 18:65652817-65652839
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159234449_1159234452 9 Left 1159234449 18:65652785-65652807 CCTTAAATGAAATCATTTTGTAG No data
Right 1159234452 18:65652817-65652839 TCAATTATGAAGGTGATGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159234452 Original CRISPR TCAATTATGAAGGTGATGAA CGG Intergenic
No off target data available for this crispr