ID: 1159235298

View in Genome Browser
Species Human (GRCh38)
Location 18:65663685-65663707
Sequence TGCTGTACCAACAGAGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159235292_1159235298 8 Left 1159235292 18:65663654-65663676 CCAGGGTAATCAGCCATCCAGGC No data
Right 1159235298 18:65663685-65663707 TGCTGTACCAACAGAGGGTGAGG No data
1159235294_1159235298 -9 Left 1159235294 18:65663671-65663693 CCAGGCTTGTCCAATGCTGTACC No data
Right 1159235298 18:65663685-65663707 TGCTGTACCAACAGAGGGTGAGG No data
1159235293_1159235298 -5 Left 1159235293 18:65663667-65663689 CCATCCAGGCTTGTCCAATGCTG No data
Right 1159235298 18:65663685-65663707 TGCTGTACCAACAGAGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159235298 Original CRISPR TGCTGTACCAACAGAGGGTG AGG Intergenic
No off target data available for this crispr