ID: 1159235603

View in Genome Browser
Species Human (GRCh38)
Location 18:65669037-65669059
Sequence GTACAAAGCCACAATTATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159235603_1159235607 23 Left 1159235603 18:65669037-65669059 CCTGCATAATTGTGGCTTTGTAC No data
Right 1159235607 18:65669083-65669105 TACCCCACCCTCAAGCTTCTGGG No data
1159235603_1159235612 28 Left 1159235603 18:65669037-65669059 CCTGCATAATTGTGGCTTTGTAC No data
Right 1159235612 18:65669088-65669110 CACCCTCAAGCTTCTGGGCTGGG No data
1159235603_1159235606 22 Left 1159235603 18:65669037-65669059 CCTGCATAATTGTGGCTTTGTAC No data
Right 1159235606 18:65669082-65669104 TTACCCCACCCTCAAGCTTCTGG No data
1159235603_1159235611 27 Left 1159235603 18:65669037-65669059 CCTGCATAATTGTGGCTTTGTAC No data
Right 1159235611 18:65669087-65669109 CCACCCTCAAGCTTCTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159235603 Original CRISPR GTACAAAGCCACAATTATGC AGG (reversed) Intergenic
No off target data available for this crispr