ID: 1159241702

View in Genome Browser
Species Human (GRCh38)
Location 18:65750816-65750838
Sequence CCGCGCGCTCCCGCTGGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 146}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159241694_1159241702 5 Left 1159241694 18:65750788-65750810 CCTGCGCGCCCTCTCGCCCTCTC 0: 1
1: 0
2: 3
3: 56
4: 834
Right 1159241702 18:65750816-65750838 CCGCGCGCTCCCGCTGGCTCCGG 0: 1
1: 0
2: 0
3: 17
4: 146
1159241697_1159241702 -4 Left 1159241697 18:65750797-65750819 CCTCTCGCCCTCTCTCTGGCCGC 0: 1
1: 0
2: 6
3: 31
4: 465
Right 1159241702 18:65750816-65750838 CCGCGCGCTCCCGCTGGCTCCGG 0: 1
1: 0
2: 0
3: 17
4: 146
1159241696_1159241702 -3 Left 1159241696 18:65750796-65750818 CCCTCTCGCCCTCTCTCTGGCCG 0: 1
1: 0
2: 1
3: 41
4: 464
Right 1159241702 18:65750816-65750838 CCGCGCGCTCCCGCTGGCTCCGG 0: 1
1: 0
2: 0
3: 17
4: 146
1159241692_1159241702 13 Left 1159241692 18:65750780-65750802 CCTCCTCTCCTGCGCGCCCTCTC 0: 1
1: 0
2: 3
3: 71
4: 630
Right 1159241702 18:65750816-65750838 CCGCGCGCTCCCGCTGGCTCCGG 0: 1
1: 0
2: 0
3: 17
4: 146
1159241691_1159241702 27 Left 1159241691 18:65750766-65750788 CCGGCGCGCTCTCTCCTCCTCTC 0: 1
1: 0
2: 2
3: 72
4: 673
Right 1159241702 18:65750816-65750838 CCGCGCGCTCCCGCTGGCTCCGG 0: 1
1: 0
2: 0
3: 17
4: 146
1159241693_1159241702 10 Left 1159241693 18:65750783-65750805 CCTCTCCTGCGCGCCCTCTCGCC 0: 1
1: 0
2: 5
3: 42
4: 319
Right 1159241702 18:65750816-65750838 CCGCGCGCTCCCGCTGGCTCCGG 0: 1
1: 0
2: 0
3: 17
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159241702 Original CRISPR CCGCGCGCTCCCGCTGGCTC CGG Intronic
900129616 1:1081860-1081882 CCCCACGTTCCCGCTGGCCCAGG + Exonic
900366742 1:2314735-2314757 CGGCGCGCTCCGCCTGACTCGGG - Intergenic
900522755 1:3113541-3113563 CAGGCCCCTCCCGCTGGCTCAGG - Intronic
900643242 1:3697262-3697284 CAAAGCGCTCCCTCTGGCTCCGG - Intronic
901506515 1:9689228-9689250 CGGCGCGCGCACGCTGGCTCTGG - Intronic
901934453 1:12618045-12618067 TCGCGCGCGCTCGCTCGCTCCGG + Intergenic
904268353 1:29331159-29331181 TCCTGCGCTCCCGCTGACTCAGG - Intergenic
905183106 1:36178540-36178562 CCTCGCGCTCCCGCTGCTCCCGG - Exonic
910936153 1:92485608-92485630 CCCCGCGCTGCAGCTGGCGCGGG + Intronic
912430549 1:109626352-109626374 CATCACGCTCCCGCAGGCTCCGG - Exonic
913654088 1:120944883-120944905 ACGCGCGCGTCCGCTGGCCCAGG + Intergenic
914644285 1:149639047-149639069 ACGCGCGCATCCGCTGGCCCAGG + Intergenic
915359395 1:155277274-155277296 CCACGCCCTCTCCCTGGCTCAGG + Intronic
915902094 1:159854706-159854728 CCGCGCCCTCCTCCTGGCTGGGG + Exonic
921039469 1:211416452-211416474 GCGCGGGCTCCCCCTGCCTCCGG + Intergenic
923678589 1:236100967-236100989 CCGCGCGGTGTCGCTGGCTTGGG - Intergenic
1062795926 10:345236-345258 CCGAGCCCTCCTGCTGGCTAAGG + Intronic
1065100322 10:22325451-22325473 GCGGGCGCTGCCGCAGGCTCCGG + Intronic
1067416426 10:46106486-46106508 CCTCGCCCTCCCGCAGGCGCCGG + Intergenic
1067436557 10:46282964-46282986 CCTCGCCCTCCCGCAGGCGCCGG + Intergenic
1067474378 10:46556461-46556483 CCGCGCGCTCCCGTTGGGGCGGG - Intergenic
1070079121 10:73168244-73168266 CCTGGCCCTCCCGCCGGCTCCGG - Exonic
1075940664 10:126388091-126388113 CCGCGCCCTCCTGCTCGCCCTGG - Exonic
1076404689 10:130203901-130203923 CCGCCCGATCCCGCCGGCCCTGG + Intergenic
1076679276 10:132163367-132163389 CCATGCGCTCCCGCAGGATCTGG - Exonic
1076733165 10:132448150-132448172 CCGCCCACTGCCGCTGGCCCTGG + Exonic
1077179516 11:1206054-1206076 CCCCAGGCTCCCGCAGGCTCTGG - Intergenic
1081593623 11:44444302-44444324 CTGCGCCCTCCCAGTGGCTCGGG - Intergenic
1081865489 11:46357477-46357499 CCACAGGCTCCAGCTGGCTCAGG - Intronic
1083616403 11:64028650-64028672 CCGCCCCCTGCCGCTGGCGCTGG + Intronic
1083658711 11:64242226-64242248 CCGCCCTCTCCCCCGGGCTCCGG - Intronic
1083920776 11:65780636-65780658 CCCCGCGCTCCCGGTGGCTGCGG - Exonic
1084028540 11:66467333-66467355 CGGCGCGGTCCCTCTGGCGCGGG + Intronic
1089455131 11:118621495-118621517 CCGCTCGCCCCCGCTAGCTCGGG - Intronic
1089557230 11:119321170-119321192 GCGCGGGCTCGCGCTGGGTCGGG - Intronic
1090042415 11:123302331-123302353 CAGCGCTCTCCGCCTGGCTCAGG - Intergenic
1091108301 11:132943148-132943170 CCCCGCGCACCAGCGGGCTCGGG + Exonic
1091584721 12:1809677-1809699 CCCCCCGCCCCCGCTGGCTGTGG - Intronic
1091594230 12:1864997-1865019 CGCCGCGCTCCCGCTGGCTGAGG + Intronic
1096813760 12:54188728-54188750 CCGGGGGCGCCCGCTGGCTCCGG + Intronic
1097166786 12:57090202-57090224 CCGGGCGGGCCCGGTGGCTCAGG + Intronic
1103848233 12:123914562-123914584 CCCCTCCCTCCTGCTGGCTCAGG - Intronic
1104755300 12:131265410-131265432 CCCACCGCCCCCGCTGGCTCCGG - Intergenic
1104961325 12:132489890-132489912 CCGGGCGCTCCCGCTAATTCAGG - Exonic
1106087783 13:26558252-26558274 CTGCGCGCCCTCGCTGGTTCTGG + Intronic
1106208365 13:27620323-27620345 GCGCGCCCTCTCGCTGGCTGCGG - Intronic
1108542069 13:51453634-51453656 CCGCCCGCGCCCGCTCGCGCCGG - Intronic
1113201108 13:107867773-107867795 CCGCCCGCACGCTCTGGCTCCGG + Intergenic
1113954069 13:114087510-114087532 CCCCGCAATCCCGCCGGCTCTGG - Intronic
1113994782 14:16056810-16056832 CCGCCCGCTCCCGTTGGGGCTGG + Intergenic
1115754841 14:36520100-36520122 CCGCGCCTTCCCACTGCCTCCGG + Exonic
1122558156 14:102592516-102592538 CCTCGCGCTCCCATTGGCTCTGG - Intergenic
1122719668 14:103715270-103715292 CCGCCTGCTCCCACAGGCTCGGG + Intronic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1125766860 15:42142019-42142041 GTGCGCCCTCCAGCTGGCTCTGG - Exonic
1127868215 15:63048617-63048639 CCGCCTGCTCCTGCAGGCTCCGG - Intronic
1129295595 15:74598430-74598452 CCCCTCGCTCCCATTGGCTCTGG - Intergenic
1129884383 15:79028413-79028435 CCTGGCAATCCCGCTGGCTCAGG + Intronic
1131977538 15:97961143-97961165 CCGGGGGCTCCCGCAGGCTGAGG - Exonic
1133031373 16:3012816-3012838 CCGCACCCTCCCCGTGGCTCAGG + Exonic
1137285704 16:47014227-47014249 CCACGCGCCGCCGCTGGCCCAGG + Intergenic
1138178787 16:54929046-54929068 CTGCGCGCTCCCCCAGGCTCGGG + Intergenic
1138657949 16:58501460-58501482 CCGAGCACTCCCATTGGCTCTGG - Intronic
1139311654 16:66032896-66032918 CCAGGGGCTCCCCCTGGCTCCGG - Intergenic
1140664236 16:77213312-77213334 CCGCAGACTCGCGCTGGCTCTGG + Intergenic
1144020926 17:11240179-11240201 CAGCGCGCTGCCCCGGGCTCCGG + Intergenic
1146126544 17:30235840-30235862 CTCCGCGCTCCCGCTGGATGGGG + Exonic
1146187211 17:30731791-30731813 CCGCTCGCCCCAGCAGGCTCCGG - Intergenic
1146332250 17:31937152-31937174 CCGCTCGCCCCAGCAGGCTCCGG - Exonic
1147150427 17:38510787-38510809 GCCCGCGCGCCCGCAGGCTCCGG - Exonic
1147539629 17:41346455-41346477 CCTCGCTCTCCAGCAGGCTCCGG + Exonic
1147541579 17:41364786-41364808 CCTCGCTCTCCAGCAGGCTCCGG + Exonic
1147545055 17:41394855-41394877 CCTCGCTCTCCAGCAGGCTCCGG + Exonic
1147661826 17:42121043-42121065 TGGCGCGCTGCTGCTGGCTCAGG + Exonic
1147684052 17:42276405-42276427 GCGCGCGCCCCCGCGGGCCCCGG - Exonic
1150840486 17:68601417-68601439 CTGCGCCCTCCCCCTCGCTCGGG + Intergenic
1152729392 17:81962057-81962079 CGGGGCGCTCCTGCTGGCGCTGG + Intergenic
1152824877 17:82458536-82458558 CCGCGCGCTCCGATTGGCTCTGG + Intronic
1154214037 18:12402239-12402261 CTGCGCGATGCAGCTGGCTCTGG + Intergenic
1159241702 18:65750816-65750838 CCGCGCGCTCCCGCTGGCTCCGG + Intronic
1160592140 18:79951001-79951023 CCGCGCGCTCCTGCGGCCTCGGG + Exonic
1160732696 19:648481-648503 CTGCACACTCCCGCAGGCTCCGG - Exonic
1160858613 19:1228271-1228293 CCGCACACTCCTGCTTGCTCCGG - Exonic
1160897964 19:1411640-1411662 CTGCGCGCTGCTGCTAGCTCTGG - Intronic
1160967547 19:1753307-1753329 CCGCCCGCGCCCGCTGGGGCAGG - Exonic
1161271565 19:3392580-3392602 CCTCCCCCTCCCACTGGCTCTGG - Intronic
1161358184 19:3831427-3831449 CCGCCCGCGCCTGCAGGCTCAGG - Exonic
1161494992 19:4581666-4581688 CCGCGCGCTGGCGTCGGCTCCGG + Intergenic
1161612377 19:5250553-5250575 CAGCACGCTCCAGCTGGCTCTGG + Intronic
1162951315 19:14073456-14073478 CCCCGCGCTCCCGCGCGCCCTGG + Exonic
1163631433 19:18419740-18419762 CCGCGCTCTTCCGTGGGCTCCGG + Intronic
1163820316 19:19492736-19492758 CCAGGCGCTCCTGCTGGCCCAGG - Intronic
1165080106 19:33302068-33302090 CCGGGCGCGCCCGCGGGCCCCGG - Exonic
1165153088 19:33772238-33772260 GCTTGCGCTCCTGCTGGCTCCGG - Exonic
1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG + Intronic
1165939882 19:39409762-39409784 GCGCCCGCCCCCGCTCGCTCTGG - Intergenic
1166791726 19:45402733-45402755 CCGAGCTCTCCCGCGGGCTCTGG + Intronic
1168678307 19:58295047-58295069 CCGCGTGCTTCCGCTGGTGCTGG - Exonic
929151145 2:38750506-38750528 CCGCGCGCTCCCGGTGCGCCCGG - Intronic
931253868 2:60554206-60554228 CCGAGCGCAGCCGCGGGCTCGGG - Intergenic
932758844 2:74426512-74426534 TTGCGCCCTCCCGCTGGGTCAGG + Exonic
942116755 2:172735815-172735837 CCGCGGGCTCCCGCGGCCTGGGG - Intronic
946227027 2:218269658-218269680 CCGCGCGCCCCCGCGGACCCCGG - Intronic
946280903 2:218664792-218664814 CCCCCCGCTCCTGCTGCCTCTGG + Exonic
946360912 2:219218898-219218920 CAGCACGGCCCCGCTGGCTCTGG + Exonic
948801397 2:240435211-240435233 CCGCTCCCTCCCGCGCGCTCCGG - Intergenic
948894753 2:240922882-240922904 CAGCGCGCTCCCTCTTGCTGTGG + Intronic
948945699 2:241217976-241217998 CTGCGCGCCCCCGCTGCCCCCGG - Intronic
1168757151 20:325699-325721 CGGCGCGCCCCCGCCGCCTCCGG - Exonic
1172404451 20:34677176-34677198 GCGCGCGCTGCCGCTGGCGCCGG + Intergenic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1178574404 21:33772164-33772186 CCGCCCGCTCCAGCTGGGCCAGG - Exonic
1179248228 21:39651374-39651396 CCAGGCCCTCCCGCAGGCTCTGG + Intronic
1180312310 22:11250599-11250621 CCGCCCGCTCCCGTTGGGGCTGG - Intergenic
1183708206 22:39487803-39487825 CCGTGCGCTCCCGGGCGCTCAGG - Exonic
1184101463 22:42343643-42343665 CCGCGCGCCCCGGCCGGCCCGGG + Intergenic
1184240266 22:43208139-43208161 CCTCCCGCTCCCGCAAGCTCTGG - Exonic
1184417184 22:44359205-44359227 CCGCCACCTCCCCCTGGCTCTGG - Intergenic
1185343059 22:50300074-50300096 CCGCGCCCTCCCGGGGACTCCGG + Intronic
1185384610 22:50526103-50526125 CCGGGCGCTGCCGCTGGCGCTGG - Exonic
952816593 3:37452413-37452435 CCGCGCGCTGCTGCTGGCGCTGG + Exonic
952889253 3:38029808-38029830 CGGGGCGCGCCCGCTGGCCCGGG - Intergenic
954838948 3:53494702-53494724 GCCCGCGCCGCCGCTGGCTCGGG - Intronic
957007139 3:74962837-74962859 CCTCCTGCTCCGGCTGGCTCCGG + Intergenic
961216479 3:125164205-125164227 CCCCTGGCACCCGCTGGCTCTGG - Intronic
967511865 3:190322214-190322236 TCGGGCGCCCGCGCTGGCTCAGG + Exonic
969261314 4:6035927-6035949 CCATGCGCTCCCGCAGGATCTGG + Exonic
969314102 4:6371231-6371253 CCGCACCCTCTGGCTGGCTCAGG + Intronic
969611133 4:8228355-8228377 CCGCGCCCTGCGGGTGGCTCGGG + Exonic
974069462 4:57110515-57110537 GCGCGCGCTCCTGCTGGCGTCGG + Intergenic
978997894 4:115178871-115178893 GCTCGTGCTCTCGCTGGCTCAGG + Intergenic
982000326 4:151015841-151015863 CCCAGCACTCCGGCTGGCTCGGG - Intergenic
984973363 4:185209743-185209765 GCGCGGGCTCCCCCTGCCTCCGG + Intronic
992468509 5:77030675-77030697 CCGCGCGCTCCAGTGGTCTCTGG + Exonic
999448319 5:151659170-151659192 CAGCCGGGTCCCGCTGGCTCTGG + Intergenic
1003573042 6:7268532-7268554 CCGAGCGCTCCCCGTGCCTCAGG + Intronic
1007629095 6:43262945-43262967 CCGCTCGGTGCCGCTGGCTGAGG + Exonic
1011633993 6:89353155-89353177 GCGCGCGGTCCCGCAGGGTCTGG + Intergenic
1014778167 6:125533977-125533999 CCGCACTCTCCCGCGGGCCCCGG + Intergenic
1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG + Exonic
1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG + Intergenic
1024082007 7:45863897-45863919 CCGGTGGCTCCTGCTGGCTCTGG - Intergenic
1028922355 7:96322101-96322123 CCACGCCCTCCCGCCGGCGCGGG + Exonic
1029459649 7:100687512-100687534 CCGCGTGCTGCCCCTGCCTCGGG + Exonic
1033306884 7:140231460-140231482 CCGCGGGCTTCCATTGGCTCGGG - Intergenic
1034129283 7:148699817-148699839 GCGCGCGCTCCCGTTGGGACCGG - Intronic
1034489455 7:151385567-151385589 CTGCTCGCTCCTGCTGGCTGAGG + Intronic
1038035423 8:23682690-23682712 CTGCGTCCTCCCTCTGGCTCTGG + Exonic
1038554187 8:28494773-28494795 CCCCGCGCTGCCGCCGGCTCCGG - Intronic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1047615277 8:126557993-126558015 CCGCGCCCGCCCTCAGGCTCGGG + Intronic
1049096114 8:140549085-140549107 GTGGGCGCTCCCGCTGGCTGTGG - Intronic
1049217637 8:141415368-141415390 CCGCTCGCTCCCGCTGTTACAGG + Intronic
1049672522 8:143876304-143876326 CCGGGCGCGCCTGCTGGCTCAGG - Intronic
1049936414 9:504911-504933 CCGCGGGCTCCCGCTCGTGCGGG + Intronic
1060765596 9:126293382-126293404 CTGCTGGCTCCAGCTGGCTCTGG - Intergenic
1060985222 9:127815780-127815802 CCACGGGCTCCCGCTTGCTGGGG + Exonic
1061421734 9:130476496-130476518 ACGCACGCTCTCGCCGGCTCGGG - Intronic
1062111618 9:134785159-134785181 CCTCGGGCTCCCGTTGGCTGTGG + Intronic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062522441 9:136963912-136963934 CCAGGGGCTTCCGCTGGCTCCGG - Intergenic
1196707270 X:118727468-118727490 CCGGCCGCTCTCGCCGGCTCAGG + Intergenic
1197709321 X:129654535-129654557 GCGCGCCCTCCCGCTCGCCCGGG - Intronic
1199760116 X:150898700-150898722 CCGCGCGCGCGCGCGGGCTTTGG - Exonic