ID: 1159246992

View in Genome Browser
Species Human (GRCh38)
Location 18:65819232-65819254
Sequence GAGTGGGTCAATGCAGATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 1, 2: 7, 3: 24, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159246992_1159246997 4 Left 1159246992 18:65819232-65819254 CCTCAATCTGCATTGACCCACTC 0: 1
1: 1
2: 7
3: 24
4: 114
Right 1159246997 18:65819259-65819281 ATTTGCATGTAATTGAAATTGGG 0: 2
1: 30
2: 131
3: 228
4: 693
1159246992_1159246996 3 Left 1159246992 18:65819232-65819254 CCTCAATCTGCATTGACCCACTC 0: 1
1: 1
2: 7
3: 24
4: 114
Right 1159246996 18:65819258-65819280 GATTTGCATGTAATTGAAATTGG 0: 1
1: 0
2: 40
3: 165
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159246992 Original CRISPR GAGTGGGTCAATGCAGATTG AGG (reversed) Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
905785678 1:40755324-40755346 GACTGGATCAATCCAGAATGGGG - Intronic
907026419 1:51124635-51124657 GAGTGGATCAATGCAAATGGAGG + Intronic
917527934 1:175805791-175805813 GAATGGGCCAATGCAAATTCTGG + Intergenic
917927117 1:179798629-179798651 GAGTGGGACAAGGCAGCTTCTGG - Intronic
918934365 1:190901180-190901202 GAGTGTGTCTGTGCTGATTGGGG - Intergenic
920624146 1:207579625-207579647 GAGTGGATCAATGCAGATTGAGG - Intronic
924273050 1:242354306-242354328 GGGTGGATCAATGCAAATTCAGG - Intronic
924322508 1:242864094-242864116 CAATGGGTCAATGCAGAGCGTGG + Intergenic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1064710903 10:18123421-18123443 GAGTGGGTTAATGCAAATGGAGG - Intergenic
1065674527 10:28160141-28160163 AACTGTGTCTATGCAGATTGTGG - Intronic
1066711662 10:38242353-38242375 GGGTGGATCAATGCAAATTCAGG + Intergenic
1070603430 10:77881644-77881666 GAGTGGGCCAATGGAGTTTCAGG + Intronic
1070794103 10:79207079-79207101 AAGTGGGTGAAGGCAGAGTGTGG + Intronic
1072844068 10:98809078-98809100 GAGTGAGTCAATGTCAATTGGGG - Intronic
1073539939 10:104310018-104310040 GGGTGGGGCAAGGCAGAGTGGGG + Exonic
1074213398 10:111360140-111360162 GAGTGGGTGAATGCTGTTTATGG + Intergenic
1075413935 10:122248912-122248934 GAGGGGGTCCATGCAGGCTGGGG + Intronic
1076593563 10:131609205-131609227 GAATTGGTCACTGCAGATGGAGG - Intergenic
1083015128 11:59445181-59445203 GAGGGGAACAATGCACATTGGGG - Intergenic
1083915721 11:65742395-65742417 GCGTGAGTCAATTCAAATTGAGG + Intergenic
1090670586 11:128942521-128942543 GACTTGGTCGATGCAGGTTGGGG - Intronic
1090805949 11:130202333-130202355 GACTTGGTCCCTGCAGATTGTGG + Intronic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1102505955 12:113384772-113384794 GAGTGGGACACTGCAGGGTGGGG + Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1108976721 13:56453596-56453618 GAGGGGAACAATGCACATTGGGG - Intergenic
1109256963 13:60095430-60095452 GGGTGGGTCAATGTAAATTAAGG + Intronic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112424027 13:99280105-99280127 GAGTGGGGCAGTGCAGATGATGG - Intronic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1116250402 14:42474508-42474530 GATGGTGGCAATGCAGATTGAGG + Intergenic
1117472983 14:56065336-56065358 GAGAGGAACAATGCACATTGGGG + Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1121529546 14:94642687-94642709 GAGAGAGTCAAGGGAGATTGTGG - Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1124344131 15:28910123-28910145 GAGTGGGGAAGTCCAGATTGGGG + Intronic
1124962036 15:34405922-34405944 GAGTGGGGAAGTCCAGATTGGGG + Intronic
1124978659 15:34552143-34552165 GAGTGGGGAAGTCCAGATTGGGG + Intronic
1125544856 15:40495758-40495780 GAATGGGACAATGGAGATTTGGG - Intergenic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1137389011 16:48066148-48066170 CAGTGGGTAAATGCATAGTGGGG + Intergenic
1138098180 16:54230121-54230143 GAGTGGGTGAGTGCAGAGTGGGG + Intergenic
1138867959 16:60847112-60847134 GACTGGGTCCACCCAGATTGAGG - Intergenic
1140300585 16:73753476-73753498 GAGTGGGTTAAAGTAAATTGAGG - Intergenic
1142094441 16:88231994-88232016 GCCTGGGTCCATGCAGAGTGTGG - Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1144182578 17:12766463-12766485 GAGAGGGTGAATGCGGTTTGTGG - Exonic
1144303056 17:13941310-13941332 AGGTGAGTCAATGCAAATTGAGG + Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1145308755 17:21689836-21689858 GTGTGAGTCAATGCTGAGTGTGG + Intergenic
1146422787 17:32704761-32704783 GATTGAGGAAATGCAGATTGAGG + Intronic
1148746665 17:49922223-49922245 GAGTGGGTCAGAGCCGGTTGGGG - Intergenic
1149520922 17:57317845-57317867 GAGTGGTTGAAAGCAGAATGTGG + Intronic
1151665948 17:75545222-75545244 GAGTGGGACAATCAAGTTTGGGG - Intronic
1151905465 17:77045611-77045633 GGGTTGGTTAATGCAGAGTGAGG - Intergenic
1153833526 18:8944060-8944082 GAGCTGGTCACTGCAGATTGTGG - Intergenic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1155847564 18:30728685-30728707 GAGTGGGACAATACACATTGGGG - Intergenic
1157259173 18:46163976-46163998 GAGGGGGTCGATGCAGAATAGGG - Intergenic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159246992 18:65819232-65819254 GAGTGGGTCAATGCAGATTGAGG - Intronic
1159337062 18:67081956-67081978 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159337072 18:67082029-67082051 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1166641752 19:44499900-44499922 GAGTGCTCCATTGCAGATTGTGG - Intronic
1166783460 19:45354120-45354142 GAGTGGGTGAAAGCACTTTGGGG - Intronic
1167677895 19:50899713-50899735 TAATGGGTCAATGTAAATTGAGG + Intergenic
926620048 2:15039453-15039475 GTGTGGGTCAAAGAAGATTAAGG + Intergenic
926706696 2:15842622-15842644 GTGTGGGTCCCTGCAGAGTGGGG - Intergenic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
934050417 2:88205930-88205952 GACTGGGTCTATGCAGGTTGGGG + Intergenic
938573223 2:132581635-132581657 GTTTGGGTCAATGCGGAGTGAGG + Intronic
939932623 2:148254197-148254219 GAGTGGGTCATGGGAGATTAAGG - Intronic
946057108 2:216911999-216912021 CATTGGGTCAATGCAGAAGGAGG + Intergenic
946299474 2:218813929-218813951 GAGTGGGTGTATGCAAAATGTGG - Intronic
946629907 2:221655838-221655860 GGTTGGGTCCATGCAGATTGGGG + Intergenic
947034464 2:225836315-225836337 GATTGTGTCCATCCAGATTGAGG + Intergenic
948513630 2:238489262-238489284 GAGTAGGTCACTGCAGAGAGAGG - Intergenic
1168871021 20:1128693-1128715 GAGGAGGTCAATGAAGATGGGGG - Intronic
1168879044 20:1190931-1190953 GAGTAGGTCAATGCCAAGTGTGG + Intergenic
1173308103 20:41871170-41871192 GAACAGGTCAATGCAAATTGAGG - Intergenic
1173707960 20:45126918-45126940 CAATGGGTCAATGCACATTTAGG + Intergenic
1173891978 20:46519782-46519804 GAGTGGATCAATGCAAATTGAGG - Intergenic
1175685640 20:61026218-61026240 GAGTGGAACAATGCACACTGAGG - Intergenic
1177355761 21:20004702-20004724 GGATGAGTCAATGCAAATTGAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1181877203 22:25948920-25948942 GAGTGGGACATTGGGGATTGGGG + Intronic
1182396703 22:30041454-30041476 GAGCCGGTCAAGGCAGAGTGGGG - Intergenic
1182558189 22:31140349-31140371 GACTGGGCCAGTGCAGAATGGGG - Exonic
1185242915 22:49755981-49756003 GGATGGGCCAATGCAAATTGAGG - Intergenic
952061757 3:29519293-29519315 GGCTGTGTCAGTGCAGATTGAGG + Intronic
956126545 3:66016450-66016472 GACTGGGTCAAAGCTGATGGCGG + Intronic
960176353 3:114522326-114522348 AAGGGGGTCAATGAAGGTTGAGG + Intronic
966745718 3:183274802-183274824 GATTGTGTCACTGCAGAATGCGG - Intronic
972887922 4:43515699-43515721 GAGTGCATCAATGAAGAATGGGG - Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
974836423 4:67256680-67256702 GAGTAGTTCAATGCAAATTTAGG + Intergenic
978440627 4:108729921-108729943 GGGTGGGGCAATGCATATGGAGG + Intergenic
980635015 4:135491110-135491132 GCCTGGGTCACTGCAGTTTGTGG - Intergenic
981935485 4:150235036-150235058 CAGTGGGGCAAGGCAGGTTGTGG - Intronic
982371892 4:154642715-154642737 GAGTGGGTCAATATAAATTGAGG - Intronic
986548030 5:8920490-8920512 CTGTGGGTCAATGCAGAGTAAGG - Intergenic
987925845 5:24340766-24340788 GAGGGGGACAATGCACACTGTGG - Intergenic
990305747 5:54492790-54492812 GAGTGCGACAATCCAGACTGGGG - Intergenic
990842120 5:60093583-60093605 GAGTGGTTCAAGACAGAGTGGGG - Intronic
991746971 5:69752971-69752993 GAAAGGGTCAGTGGAGATTGCGG + Intergenic
991750734 5:69802271-69802293 GAAAGGGTCAGTGGAGATTGCGG - Intergenic
995142620 5:108749555-108749577 GAGCGGGTCAAGGGAGACTGCGG - Intronic
996007946 5:118446048-118446070 AAGTGGGTCAAAGAAGAATGTGG - Intergenic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1003282589 6:4706824-4706846 GAGAGTGGCAAAGCAGATTGAGG + Intronic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1007576955 6:42931302-42931324 GGGTGGGTCACTGGAGGTTGCGG - Intronic
1009315142 6:62209686-62209708 GAGGGTGCCAATCCAGATTGAGG - Intronic
1009370476 6:62894376-62894398 GTGTGGATTAATGCAAATTGAGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1018415618 6:163599998-163600020 GAGCGGGTCAATGTAAAGTGAGG - Intergenic
1023304899 7:38815651-38815673 GATTGTGCCCATGCAGATTGAGG - Intronic
1023672204 7:42589135-42589157 GAGAGGAACAATGCACATTGGGG - Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1038044621 8:23755644-23755666 CAGTGGGTCACTGCAGTTGGTGG + Intergenic
1042344326 8:67712047-67712069 GTGTGGGTCACTGCAGACTTAGG - Intronic
1051097234 9:13480714-13480736 GAGTGGCTCCAGGCACATTGGGG - Intergenic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1056474602 9:86941708-86941730 GAGGGTGTCAATACAGATGGTGG + Intergenic
1057544498 9:96007468-96007490 GAAGGGGTCACTGAAGATTGAGG + Intronic
1186470985 X:9822193-9822215 GAGTGGGTGAACCCCGATTGAGG + Intronic
1186856952 X:13635923-13635945 GAGTGGGCCCATACAGAGTGGGG - Intergenic
1190364636 X:49680108-49680130 GGGTCAGTCAATGCAAATTGAGG + Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1193390400 X:80920319-80920341 GACTTGGACATTGCAGATTGGGG + Intergenic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic