ID: 1159249098

View in Genome Browser
Species Human (GRCh38)
Location 18:65850465-65850487
Sequence CTCTGTAAATACATGTAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159249094_1159249098 8 Left 1159249094 18:65850434-65850456 CCAATCTTCAGAAAAGAGAGGAG 0: 1
1: 0
2: 3
3: 26
4: 314
Right 1159249098 18:65850465-65850487 CTCTGTAAATACATGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159249098 Original CRISPR CTCTGTAAATACATGTAGCG AGG Intronic
911942470 1:104065271-104065293 CCCTATAAATACATATAGCTAGG - Intergenic
915629425 1:157140041-157140063 ATGTGTTAATACATGTAGAGTGG + Intergenic
919444010 1:197678190-197678212 CTCTGTAATTACATGTGTCATGG - Intronic
920546132 1:206820155-206820177 GTCAGTAAATACATGAAGCTTGG - Intronic
1063508912 10:6627548-6627570 CTCTGTGAAAACGTGTAGCAAGG + Intergenic
1074523462 10:114245214-114245236 CTCTGGAAAAACATGCAGCTGGG + Intronic
1086999703 11:93403113-93403135 CTCTGAAAATACATCTATTGTGG + Intronic
1092387450 12:8047103-8047125 CTCTATAAACAAATGTAGCTTGG - Intronic
1093733979 12:22597779-22597801 ATATGAAAATACCTGTAGCGAGG + Intergenic
1108891159 13:55261549-55261571 CTGTGTAAATAAATGAAGCATGG + Intergenic
1108994526 13:56710979-56711001 GTATGTAAACACATGTAGCTAGG - Intergenic
1109294939 13:60518597-60518619 CTTTGTAAATACATGTAAAAAGG + Intronic
1118483461 14:66190005-66190027 CTCTATAAAAACATTTAGCCAGG - Intergenic
1125990631 15:44103442-44103464 CTTTGAAAATACATGTTGTGAGG - Intronic
1131719435 15:95151444-95151466 CTCTGCACATACATGTAGCATGG + Intergenic
1140638004 16:76939282-76939304 CTTTGTAAATACCTGTACAGTGG + Intergenic
1146611889 17:34313395-34313417 CTCTGTAAGTTCATGTTGCAAGG - Intergenic
1153203150 18:2667373-2667395 CTTTGCAAATACATATAGCTAGG + Intronic
1156737299 18:40275876-40275898 CTCTTTAAATGCATGAAGGGTGG - Intergenic
1159249098 18:65850465-65850487 CTCTGTAAATACATGTAGCGAGG + Intronic
1162960308 19:14121778-14121800 CTCAGTAAATACATGATGCTTGG - Intronic
1166935767 19:46331542-46331564 CTCTGCAAATACATGTAAGATGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
937839881 2:126514271-126514293 CTCCCTAAATACATGAAGCGTGG - Intergenic
1169582432 20:7038803-7038825 CTGTGTAAATAGAGGTAACGTGG + Intergenic
1169764853 20:9137822-9137844 CTCTGTAAATACATACAGAATGG - Intronic
1169870235 20:10241382-10241404 CTCAGTAAATACATGGGGAGTGG - Intronic
1172518456 20:35552146-35552168 CTCTGTAGGTACAGGTAGGGTGG + Intronic
1175390550 20:58624600-58624622 CTCTGAAAACACATGAAGCACGG - Intergenic
1183690832 22:39387501-39387523 CTCTGTAAAGCCATGAAGGGTGG + Intergenic
1184627536 22:45748304-45748326 CTATGTAAATACATATAATGGGG - Intronic
950658523 3:14452291-14452313 CTCTGTAAACAGAAGTAGCGTGG + Intronic
952114297 3:30160700-30160722 AAATGTAAATACATTTAGCGTGG + Intergenic
955218963 3:57008140-57008162 CTAGGAAAGTACATGTAGCGTGG - Intronic
956364505 3:68485337-68485359 CACTGTTAACACATGTAGTGTGG - Intronic
959889764 3:111541410-111541432 CTCTGTAAATAGAAGTAACTAGG + Intronic
964650730 3:159008592-159008614 CTCTGTAAATGCCTGTACCCAGG + Intronic
966317793 3:178668126-178668148 CTCAGCAAATACATGTTCCGTGG - Intronic
967399242 3:189042057-189042079 CTCTGTAAACACATGTTGATGGG + Intronic
967762035 3:193237098-193237120 CTCTGTAATTACATTTAGCAGGG + Intergenic
970745444 4:19289156-19289178 CTCTTTTAATACATGGAGCATGG - Intergenic
972404717 4:38734714-38734736 CACTGTAAATACTTGTTGCATGG + Intergenic
972795882 4:42419250-42419272 CTCAGTAAATACTTGTTGAGTGG - Intronic
973064943 4:45778193-45778215 CTCTCAAAATACATGTAACTTGG + Intergenic
975191862 4:71473279-71473301 ATCTGTTAATACATGTATCCAGG - Intronic
976361706 4:84186715-84186737 CTCTGTAAATATTTGTTGAGCGG - Intergenic
980199900 4:129642580-129642602 CTCTCTAAATACATAAAGAGTGG + Intergenic
983332896 4:166354185-166354207 CTGTGTAAGTACATGTAGGATGG + Intergenic
990250164 5:53905588-53905610 CTCTCTAAAGAAATGTAGTGTGG - Intronic
1000170505 5:158698435-158698457 CTGTGTAAATAAATGCAGCCTGG - Exonic
1002857474 6:1051002-1051024 CTCTGTAAAACCATGTAGGATGG + Intergenic
1002948150 6:1782220-1782242 CTTTTTAAATACATGTAACTGGG - Intronic
1006300851 6:33192889-33192911 CTCTGTAATTACACGGGGCGGGG - Intergenic
1016224984 6:141723883-141723905 CTCTATAAATCCATGTTGCTGGG + Intergenic
1023591476 7:41784962-41784984 CTCTGTAAATAAATGAAGGCAGG - Intergenic
1024214714 7:47238811-47238833 GTCTGTATATACCTGTAGTGCGG - Intergenic
1031748035 7:125530125-125530147 CTATGTAAATAAATGTAGAGTGG - Intergenic
1039131827 8:34273594-34273616 CTGTGTACATACATGTACTGTGG + Intergenic
1041407863 8:57520007-57520029 TTCTGTTATTACATGTAGCCTGG - Intergenic
1042066750 8:64885816-64885838 CTCTGTACATACATGGTGGGAGG - Intergenic
1044857253 8:96489196-96489218 CTCTTTAAAAATATGTAGCCAGG - Intergenic
1051528059 9:18069702-18069724 CCCTGTCAATACATGGAGGGTGG + Intergenic
1055919219 9:81440194-81440216 CTCGGTAAATACATGGGGCCTGG + Intergenic
1188359413 X:29234064-29234086 CTCCATAAATAAATGCAGCGTGG + Intronic
1190628803 X:52365229-52365251 CTCTGTAATTACATATTTCGTGG - Intergenic