ID: 1159249260

View in Genome Browser
Species Human (GRCh38)
Location 18:65852531-65852553
Sequence TGTGCCCCAGGTGAGAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159249255_1159249260 20 Left 1159249255 18:65852488-65852510 CCGCTTATTTACAATGTGGCTTC 0: 1
1: 0
2: 1
3: 27
4: 227
Right 1159249260 18:65852531-65852553 TGTGCCCCAGGTGAGAGAAAGGG 0: 1
1: 0
2: 3
3: 29
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159249260 Original CRISPR TGTGCCCCAGGTGAGAGAAA GGG Intronic
900822707 1:4901579-4901601 TGTGACCCAGATGGGAGACATGG - Intergenic
901296741 1:8166605-8166627 TGGTGCCCAAGTGAGAGAAAAGG + Intergenic
901971369 1:12911712-12911734 CAGGCCCCAGGTGAGTGAAAGGG + Intronic
902013798 1:13290028-13290050 CAGGCCCCAGGTGAGTGAAAGGG - Intergenic
902575958 1:17377752-17377774 TGTGACCCAGGTGAGAGGATGGG - Intronic
902855346 1:19199638-19199660 TGTGTCCCAGGTGAGAGTGATGG - Exonic
902866932 1:19285875-19285897 TGTGTACCAGGTGAGAGCCAGGG - Exonic
903334285 1:22614523-22614545 AGTGCCACACATGAGAGAAATGG - Intergenic
904351489 1:29909957-29909979 TGGACCCCAGGTGACCGAAAGGG - Intergenic
905197036 1:36287847-36287869 TGTCCCCCAGGGGAGAAAGACGG - Intronic
905748258 1:40437816-40437838 TGTCTCCCAGGAGAGAGAAGGGG + Intergenic
907160214 1:52364191-52364213 TGTGCCCCAAGTGGAAGAACAGG - Intronic
907749310 1:57246794-57246816 TGTGCCCTAGGTGTGAGACATGG + Intronic
908879099 1:68710522-68710544 TGTGCCCCAGATATGAGAAATGG + Intergenic
909169789 1:72281497-72281519 TGTGCCACAGGGGTGGGAAACGG + Intronic
909503598 1:76362739-76362761 TGTGTCCCAGATGTGAGACATGG - Intronic
909932999 1:81519744-81519766 TGTGCCCAAAGTGACAGATACGG + Intronic
910065855 1:83150231-83150253 TGTGTCCCAGGAGAAATAAAGGG - Intergenic
910563488 1:88618199-88618221 TGTGCCCTGGGTGTGAGACATGG - Intergenic
911046349 1:93631885-93631907 TGTGCCACAAGTCAGAGAGAAGG - Intronic
911972204 1:104452721-104452743 TGTGCCCCAGATGTGAGACATGG + Intergenic
913358972 1:117957765-117957787 TGTGGCCCAGGGGAGCCAAAAGG + Intronic
914680549 1:149935666-149935688 TGGGCCCCAGGGGTGAGGAAGGG - Exonic
914988018 1:152476334-152476356 TGTGACCCAGATGTGAGACATGG - Intergenic
915022704 1:152796658-152796680 TCTGCCCCAGCTGTGAGACAGGG - Intronic
915829285 1:159110974-159110996 TGTGCTCTAGGTGAGGGTAAAGG + Intronic
916282929 1:163072490-163072512 TTTGCCAGAGGTAAGAGAAAAGG + Exonic
916345717 1:163789010-163789032 TATCCCCCAGGTGAGAGTTAAGG - Intergenic
917034004 1:170726365-170726387 TGTCCCCCAGGAGAGATAATCGG - Exonic
917487329 1:175466956-175466978 TGTGGCAGAGGTGGGAGAAATGG + Intronic
919360530 1:196588044-196588066 TTTGCCTCAGCTGATAGAAAAGG - Intronic
920212110 1:204335738-204335760 TGAGCCCCGGGGGAGTGAAAGGG + Intronic
922195209 1:223353724-223353746 GGTGCCCCAGGACAGAGGAAGGG + Intronic
923358498 1:233184132-233184154 TGGGCTACATGTGAGAGAAAAGG - Intronic
923461279 1:234211517-234211539 TGTGACCCAGATGTGAGACATGG + Intronic
923654825 1:235906594-235906616 TGTGCCTCAGGCAAGAGAGAAGG - Intergenic
923890873 1:238214083-238214105 TGTGCCCCAGATGTGAGACATGG - Intergenic
924772334 1:247088735-247088757 TGTGCCCAAGGTGTGGGGAAAGG + Intergenic
924791457 1:247253734-247253756 TGCGCCCGAGGTTAGTGAAAGGG - Intergenic
1062766350 10:68832-68854 CCTGCCCCAAGTGGGAGAAAGGG + Intergenic
1062805523 10:416871-416893 TCTGCCTCAGGTGAGGGGAATGG - Intronic
1064742580 10:18448748-18448770 TGTGCCCTGGGAGAGAGAAAAGG + Intronic
1065127190 10:22584947-22584969 TGTGCCCCCGGTGAGTGACAGGG - Intronic
1066228054 10:33403815-33403837 TGTGCTCCAGGTGCGAGGCATGG - Intergenic
1067689661 10:48493644-48493666 AGTTCCCCAGGAGAGACAAAAGG - Intronic
1070350299 10:75585153-75585175 GCTGCCCTTGGTGAGAGAAAGGG - Intronic
1071159356 10:82727896-82727918 TGTGACCCAGATGAGAGACATGG + Intronic
1072660447 10:97360514-97360536 TGTGTCCCAGGAGAGAGGAGTGG + Intronic
1072816348 10:98512969-98512991 AGTGTCCCAGGAGAAAGAAATGG - Intronic
1074488487 10:113914723-113914745 TGTGCCACAGGGGGAAGAAAAGG - Exonic
1075599896 10:123759878-123759900 AGTGGCCCAGTTGAGAGCAAGGG - Intronic
1076025951 10:127113623-127113645 TGTTCTCCAAGAGAGAGAAATGG - Intronic
1076060585 10:127411205-127411227 CGAGCCCCAGGTGAGAGAGCAGG + Intronic
1076725781 10:132412391-132412413 TGTGCCCCATGTCAGAGGATTGG + Intronic
1076946017 10:133651124-133651146 AGAGCCCCAGGTCAGAGAACAGG + Intergenic
1077483411 11:2827138-2827160 TGTCCCCCAGGTAGGAGATAAGG + Intronic
1077793813 11:5469754-5469776 TATGACCCAGTAGAGAGAAAGGG - Intronic
1079005041 11:16785600-16785622 TCTACCCAAGGGGAGAGAAAGGG - Intronic
1079098765 11:17527644-17527666 GGTGCCCCAGTGGAGTGAAAGGG - Intronic
1079138275 11:17788799-17788821 CATGGCCCAGGTAAGAGAAATGG - Intronic
1079721872 11:23825802-23825824 TGTGCCCCAGATTTGAGACATGG - Intergenic
1079753496 11:24227987-24228009 TGTGACCCAGATGTGAGACATGG - Intergenic
1081120809 11:39263166-39263188 TGTGACCCAGATGTGAGACATGG - Intergenic
1082025973 11:47572640-47572662 TGTGCCTAAGGTCTGAGAAAAGG + Exonic
1082680125 11:56157371-56157393 TGTGCATAAGGTGAGAGATAAGG - Intergenic
1083099900 11:60292291-60292313 TGTGCCCCAGCTGGGAAACATGG + Exonic
1083136029 11:60677837-60677859 TGTACCCCAGATGTGAGACATGG - Intergenic
1083205354 11:61145512-61145534 TGTGGCATTGGTGAGAGAAAGGG - Intronic
1083948979 11:65943389-65943411 TGGGCCCCAGGTGTGGGAGAAGG + Intergenic
1085056510 11:73407485-73407507 TGTGGCCAGGGTGAGAGAAGTGG - Intronic
1085331280 11:75653458-75653480 AGTGCCACAGGTCAGAGAATGGG - Intronic
1085449746 11:76624760-76624782 TATGCCCCAGGTGTTAGAGAAGG + Intergenic
1085504776 11:77051831-77051853 TGTGGCCTAGGTGTGGGAAAGGG + Intergenic
1089613249 11:119681311-119681333 TGGGCCCCAGGTGAGAGCGCAGG + Intronic
1090073526 11:123564197-123564219 TGTGTCCCTGGCCAGAGAAAAGG + Intronic
1090120891 11:124026845-124026867 TCAGCCACTGGTGAGAGAAAAGG + Intergenic
1090516001 11:127427653-127427675 TGTCTCACAGGAGAGAGAAAGGG - Intergenic
1093590383 12:20895520-20895542 TGTGACCCAGATGTGAGACATGG - Intronic
1094725658 12:33112863-33112885 TGTCTCCCAGGTGAGTGCAATGG + Intergenic
1094828011 12:34287179-34287201 TCTGCCCCAGGTGTGAGCCAGGG - Intergenic
1094828108 12:34287609-34287631 CGTGCCCCAGGGGCGAGCAAGGG - Intergenic
1096396693 12:51271211-51271233 ATTGCCCCAGATAAGAGAAACGG - Intronic
1096684996 12:53282426-53282448 TGTGCCCAAGGTGAAAGAATAGG + Exonic
1096717528 12:53500198-53500220 TGTGACCTTGGAGAGAGAAAGGG - Intergenic
1096865329 12:54559267-54559289 TCTGCCTCTGGTAAGAGAAAAGG - Intronic
1097400650 12:59124412-59124434 TGTGACCCAGATGCGAGACATGG - Intergenic
1099635267 12:85204575-85204597 TGTGACCTAGATGTGAGAAATGG + Intronic
1100328822 12:93567051-93567073 TGTGGCCCAGGTGAGCCAATGGG - Intergenic
1101167100 12:102049735-102049757 TGTGCCCCAGAAGCCAGAAAAGG + Intronic
1101728328 12:107406060-107406082 TATGCCCCAGCTAAGAGAAGTGG - Intronic
1102774598 12:115507541-115507563 GGTGCCCCAGGTCACAGAACTGG - Intergenic
1104210434 12:126683635-126683657 TGTGCTCCGGGTGTGAGACATGG - Intergenic
1106848677 13:33764889-33764911 TGTGCCTCAGGTGTGGGAGAGGG + Intergenic
1106865618 13:33960731-33960753 GGTGCCCTAGGTGAGAAATAAGG - Intronic
1107886520 13:44878293-44878315 TGAGACCCAGGGGAAAGAAAGGG - Intergenic
1109364051 13:61332484-61332506 GGTGTCCCATGTGAGAGGAATGG - Intergenic
1110359721 13:74611152-74611174 TGTGACCCAGATGTGAGACATGG + Intergenic
1111397572 13:87685074-87685096 TGTGCCCAAGGTCAGACACATGG + Exonic
1111463053 13:88571456-88571478 TGTACCAAAGATGAGAGAAAAGG + Intergenic
1112302094 13:98239856-98239878 TGTGCTAGAGGAGAGAGAAAGGG + Intronic
1113189086 13:107722856-107722878 TGGGACCCAGGTGAGAGGGAAGG - Intronic
1114780387 14:25532658-25532680 TGTGCCCTGGGTGTGAGATATGG - Intergenic
1115167860 14:30469886-30469908 TCTGAACCAGGTGAGAGAAGAGG - Intergenic
1115518522 14:34209468-34209490 TGTGCCCGCTTTGAGAGAAATGG - Intronic
1116364141 14:44039327-44039349 TGTGCCCTAGATGTGAGACATGG + Intergenic
1117011346 14:51473632-51473654 TGTGCCCCAGGTTAGGGCATAGG + Intergenic
1119460287 14:74796932-74796954 TGTGCCTTAGGAGACAGAAAAGG - Intronic
1121438965 14:93936882-93936904 GATGCCACAGGTGACAGAAATGG - Intronic
1121788314 14:96679793-96679815 TGAGCTCCAGCTGGGAGAAAAGG + Intergenic
1122297141 14:100712067-100712089 TGTGACCCAGGTGTTAGAACTGG + Intergenic
1122692143 14:103536487-103536509 TGTGCCCCAGGTGAGTAACAAGG - Exonic
1202920120 14_KI270723v1_random:23719-23741 AGAGCCCCAGGTCAGAGAACAGG + Intergenic
1202924801 14_KI270724v1_random:13923-13945 AGAGCCCCAGGTCAGAGAACAGG - Intergenic
1124137204 15:27045360-27045382 TGTTCCCCCGGTGAGAGAAGTGG - Intronic
1126581733 15:50248362-50248384 AGTGCCCAAGGTTAGAGACAAGG + Intronic
1126753955 15:51906075-51906097 TGAGCACCAGGTGAGAAAGAGGG + Intronic
1129378487 15:75150597-75150619 TGACCCCAAGGTGAGAGGAATGG - Intergenic
1130727989 15:86460934-86460956 TTTGACCCATGTGAGAGAACTGG + Intronic
1131069852 15:89459460-89459482 TATCCCCCAGCTGGGAGAAAAGG - Intergenic
1131427096 15:92354533-92354555 TGTGCCCTGGGTGTGAGACATGG + Intergenic
1131611855 15:93973414-93973436 TGAGACCCAGGGGAGAGCAAAGG - Intergenic
1132603099 16:782609-782631 TGTGGCCCAGGAGGGAGACAGGG + Intronic
1133226045 16:4340856-4340878 TGAGCCCCAGGTGAGAAGAAGGG + Intronic
1135871153 16:26151824-26151846 TGTTCCCCACCTGGGAGAAAGGG - Intergenic
1138207345 16:55134581-55134603 TGAGCCCCAGGTGAGAGCTGTGG + Intergenic
1138947180 16:61865449-61865471 TGTGCATTGGGTGAGAGAAATGG + Intronic
1139083844 16:63560816-63560838 TGTGCCCTAGATGTGAGACATGG - Intergenic
1140126540 16:72123197-72123219 TGAGCCCCAGGTGAGTTCAAGGG + Intronic
1140141399 16:72261589-72261611 TGTCACCCAGGTGAGAGAAATGG + Intergenic
1140300171 16:73749662-73749684 AGTGTCCCAGGGAAGAGAAAAGG + Intergenic
1140351722 16:74268448-74268470 TGTGCCCAAGTTTAGAGAACAGG + Intergenic
1141002246 16:80319049-80319071 AGTGCCCCAGATGGAAGAAATGG - Intergenic
1141698879 16:85633367-85633389 TCTGCCCCACGTTACAGAAAAGG - Intronic
1141750572 16:85955379-85955401 TCTGCCTCAGGTGAGTGAACAGG - Intergenic
1141990027 16:87603998-87604020 TCTGCCCAAGCCGAGAGAAAGGG + Intronic
1142431035 16:90027506-90027528 TGTGCTCCAGGTGAGCAGAAGGG + Intronic
1143627695 17:8120747-8120769 TGTTAGCCAGGTGAGAGAGAGGG - Exonic
1144377690 17:14661762-14661784 AGTGACCCAGATGAGAGATATGG + Intergenic
1144635449 17:16904743-16904765 TGTCCCCCACCTGACAGAAATGG + Intergenic
1145203035 17:20963860-20963882 TGTCCCCCATCTGACAGAAATGG + Intergenic
1145753725 17:27374460-27374482 TGTGACCCAGATGTGAGACATGG + Intergenic
1146164881 17:30579983-30580005 TGTCCCCCACCTGACAGAAATGG + Intergenic
1146798810 17:35802052-35802074 TGTGCCCCATGAGAGACATAAGG + Intronic
1147124643 17:38358107-38358129 TGTGCTTCAGGTGACAGAAAAGG - Intronic
1147440929 17:40446864-40446886 TGTGGCCCAGGTCACAGCAAGGG - Intronic
1148581969 17:48750348-48750370 TGTGCTCCAGGTAGGATAAATGG - Intergenic
1149445094 17:56707425-56707447 TGTGCCCCAGGTCACAGAGCTGG + Intergenic
1154178577 18:12108891-12108913 TGTGCCCTGGATGTGAGAAATGG - Intronic
1154492050 18:14930115-14930137 TGTGGCTCAGGTGAGTGAATAGG + Intergenic
1156611856 18:38734416-38734438 TGTGCTCCAGGTGCGGGAAAAGG - Intergenic
1156627947 18:38932232-38932254 AGTGCCCCAGATGAGAGCCAAGG + Intergenic
1159249260 18:65852531-65852553 TGTGCCCCAGGTGAGAGAAAGGG + Intronic
1159518447 18:69488147-69488169 TGTGCTCAAGGGGAGAGAAAGGG + Intronic
1159761239 18:72429673-72429695 TGTGACCCAGTTGCGAGACATGG - Intergenic
1162324230 19:9989328-9989350 AGGGCCCCACGGGAGAGAAAGGG - Exonic
1162949342 19:14061573-14061595 AGTGTCCAAGGTGGGAGAAAAGG - Intergenic
1165394864 19:35558564-35558586 TGTGCCCAAGGTGAGAGCCAGGG - Exonic
1165461592 19:35947021-35947043 TGTGCCCCAGGTCATGAAAAGGG - Intergenic
1165792028 19:38498387-38498409 TGTGGTCCAGGTGGGAGACAAGG + Intronic
1166179145 19:41094854-41094876 GGTGCCCCAGGTGAGGGGAGTGG - Intronic
1168397775 19:56063706-56063728 TGTGTCCCATGTGGGAGAAGAGG - Intergenic
1168414656 19:56160489-56160511 TGGGCCGCAGGAGAGAGAAGAGG - Exonic
1168457877 19:56527965-56527987 TGTGGCCCAGGGAAGACAAAAGG - Exonic
1168583903 19:57577596-57577618 TGTGGCCAAGCTGAGAGAACAGG - Intronic
925083994 2:1093612-1093634 TGTGTCAAAGTTGAGAGAAAAGG - Intronic
926926299 2:17991448-17991470 TGTGACCCAGATGTGAGACATGG + Intronic
928571642 2:32615189-32615211 TGTGTTGGAGGTGAGAGAAATGG - Intronic
929665734 2:43832323-43832345 CTTGACCCAGATGAGAGAAATGG - Intronic
930534715 2:52631415-52631437 TCTGCCCCTGTGGAGAGAAAGGG + Intergenic
932255007 2:70277029-70277051 TGTGCCCTCTGTGAGAGAAAAGG + Exonic
932325508 2:70857409-70857431 TGTGCCAGATGTTAGAGAAAAGG + Intergenic
933508055 2:83203915-83203937 TGTGACCCAGATGTGAGACATGG - Intergenic
935442861 2:103122635-103122657 TGTGCCCCAGGAATGAGAAGAGG + Intergenic
935557638 2:104527853-104527875 TGTTCCACAAATGAGAGAAATGG - Intergenic
936992847 2:118384274-118384296 GCTGCCCCAGGTGAGATAACAGG - Intergenic
938595829 2:132786188-132786210 TGTTTTCCAGGTGGGAGAAATGG + Intronic
939154365 2:138506609-138506631 TGTGCCTAAGGTGAGAGTACTGG + Intronic
940380110 2:153005064-153005086 TGTGGCCCATGGGAGAGATAGGG + Intergenic
940653519 2:156461010-156461032 TGACCCCCAGGAGAGAGAGAGGG - Intronic
941247184 2:163113224-163113246 TGTGGCCTAGGTGTGAGACATGG - Intergenic
941511740 2:166419093-166419115 TCTGCCCCAATTTAGAGAAAAGG - Intronic
942183684 2:173404115-173404137 TGTGCTCCTGGAGACAGAAATGG + Intergenic
942429743 2:175898097-175898119 TGTGGCCCAGGCTAGAGTAAAGG + Intergenic
944272137 2:197796020-197796042 TGTGCCCTGGATGTGAGAAATGG - Intergenic
946673165 2:222128268-222128290 TGTGCAGCAGGTGAGAGAAGAGG - Intergenic
947220535 2:227787604-227787626 TGGTCCCCAGGGGAGAAAAAGGG - Intergenic
947552793 2:231058598-231058620 TGTGGCCCAGGGGAGCCAAAAGG + Intronic
1168893563 20:1309128-1309150 TGTCCCCCAGGTCAGAGAGGGGG - Exonic
1169128404 20:3147960-3147982 TGTGATCCACGTGAGTGAAACGG + Exonic
1169347395 20:4839415-4839437 TGGCCCTGAGGTGAGAGAAAAGG + Intergenic
1171001820 20:21422945-21422967 TGTGCCCTAGATGTGAGACATGG - Intergenic
1173848955 20:46205893-46205915 TGTGCCCCAGGTTGGAGTGATGG - Intronic
1173997843 20:47353062-47353084 TCTGCCACAGGAGAGAGAAGGGG + Intronic
1175383493 20:58579556-58579578 TGTCCCCAGGGTGAGAGTAAGGG - Intergenic
1175825388 20:61933965-61933987 TGTGGCCCAGGTGACAGAAAAGG + Intronic
1177554582 21:22672660-22672682 TGTGACCCAGATGTGAGACATGG + Intergenic
1177641038 21:23845312-23845334 TGAGCCCCAGATGTGAGACATGG - Intergenic
1178586369 21:33874526-33874548 TGTTCCCCAAGTGAGTGAACAGG + Intronic
1179061910 21:37987099-37987121 TGTGCCCTAGAACAGAGAAAAGG - Intronic
1179361612 21:40714443-40714465 TGTTCCCCAGGTGAGGGACATGG + Intronic
1179815111 21:43900661-43900683 TGCTGCCCAGGTGAGGGAAAGGG + Intronic
1182420339 22:30245781-30245803 GGTGCACCAGGAGAGAGAAAAGG + Intronic
1182437447 22:30339853-30339875 TGTGCCACAGGTGGGAGACTGGG - Intronic
1183226983 22:36557141-36557163 GGTGCACCTGGTGACAGAAATGG + Intergenic
1184355339 22:43975787-43975809 TGCACCCCAGGTGAGGGACAGGG - Intronic
1184915140 22:47563910-47563932 GGTTCCCCAGGTGGGAGGAACGG - Intergenic
949811626 3:8012671-8012693 AGAACCCCAGGTTAGAGAAAAGG - Intergenic
950332779 3:12169723-12169745 TGTGTCCCAGGTGAGGAAAGGGG - Intronic
951525615 3:23650027-23650049 TGTAACCCAGGAGAGAGACAAGG + Intergenic
952734971 3:36680587-36680609 TGTGCCCTAGATGTGAGACATGG - Intergenic
953019623 3:39105154-39105176 GAGGCCCCAGGTGAGAGAAGTGG - Intronic
953819532 3:46193337-46193359 TGTGAAGCAGGTGAAAGAAATGG + Intronic
955079870 3:55648754-55648776 TGAGCCCCAGGCAGGAGAAATGG + Intronic
957081469 3:75639345-75639367 AGAGCCCCAGGTCAGAGAACAGG - Intergenic
957495173 3:80982732-80982754 TGTGCCCTAGATGTGAGACATGG + Intergenic
958083774 3:88780282-88780304 TGTGCCCCAGATGTGAGACATGG - Intergenic
959004796 3:101008249-101008271 TGTGACCCAGATGTGAGACATGG - Intergenic
959214741 3:103437305-103437327 TGTGCCCCAGATGTGAGATATGG - Intergenic
960284739 3:115815097-115815119 TGTACCTCAGGTAAGTGAAACGG - Intronic
960564342 3:119117935-119117957 TGTGACCCAGATGTGAGACACGG - Intronic
961229595 3:125291778-125291800 TGTGCCCAAATTTAGAGAAATGG + Intronic
961315067 3:126028823-126028845 TGTGCCCTAGATGTGAGACATGG + Intronic
962121128 3:132561033-132561055 TGTCCAACAGGTGAGAGAACTGG + Intronic
962294124 3:134165567-134165589 TGTGCCCCAAGTGCCAAAAAAGG + Intronic
962661963 3:137611214-137611236 TCTATCCCAGGTGAGTGAAATGG + Intergenic
964434711 3:156639425-156639447 TGTAAGCCAGGTGAGAGATAAGG - Intergenic
967260162 3:187634204-187634226 TGTGCCCCAGATGTGGGATATGG - Intergenic
969097224 4:4742832-4742854 TGGGCCTCAGGGGAGAGAACAGG + Intergenic
971149696 4:24018797-24018819 GGTCCCCCAGGTGGGGGAAATGG - Intergenic
972156056 4:36163440-36163462 TTTACCACAGTTGAGAGAAAAGG + Intronic
974177711 4:58345312-58345334 TGTGCCCTAGATGTGAGACATGG + Intergenic
974465261 4:62247479-62247501 TGTCCCTCAGGAGGGAGAAATGG - Intergenic
974702698 4:65472223-65472245 TGTGCTCCAGATGTGAGACAGGG - Intronic
975303116 4:72815170-72815192 TGTACCCCAGGTAATAGCAATGG - Intergenic
977271033 4:94917449-94917471 TGTGCCCTGGATGTGAGAAATGG + Intronic
977322323 4:95533032-95533054 AGTGAACCAGTTGAGAGAAATGG + Intronic
977861300 4:101963772-101963794 TGAGTACCAGGTGCGAGAAAAGG - Intronic
979377323 4:119962368-119962390 TGTGCCCTGGGTGTGAGACATGG - Intergenic
980346823 4:131633124-131633146 TGTGTTCCAGGTGAGGTAAAAGG + Intergenic
980458349 4:133073636-133073658 TGTGCCCTAGATGTAAGAAAAGG + Intergenic
981070254 4:140528031-140528053 TGAGTCCCAGATGAGACAAATGG - Intronic
981205480 4:142034927-142034949 TGTGTTCCAGGTGATAGAATTGG - Intronic
984416056 4:179459511-179459533 TGTGACCCAGATGTGAGACATGG + Intergenic
984799321 4:183698968-183698990 TATAGACCAGGTGAGAGAAATGG - Intronic
984865601 4:184277704-184277726 TGTGCCCTAGATGTGAGACATGG + Intergenic
985089112 4:186345437-186345459 TGTTCCCAAGGAGGGAGAAAAGG - Intergenic
985316883 4:188667520-188667542 TGTTCCCCAGGTGAGTGCAGTGG + Intergenic
985449426 4:190051777-190051799 AGAGCCCCAGGTCAGAGAACAGG + Intergenic
985499889 5:236329-236351 TGTGCTGCAGGTCAGAGAGAGGG - Intronic
988009667 5:25465460-25465482 TGTGCCCTAGATGTGAGACATGG + Intergenic
988448021 5:31310298-31310320 TGTGCCCTAGGGGTGAGACATGG - Intronic
988794392 5:34639176-34639198 TTTGGTCCAGGTGAGACAAATGG - Intergenic
993090376 5:83418639-83418661 TGTGGCTCCTGTGAGAGAAAGGG + Intergenic
993691573 5:91007411-91007433 TAGGACCCAGGGGAGAGAAAAGG - Intronic
995544329 5:113215026-113215048 TGTGTTCCAGGTAAGGGAAATGG - Intronic
995564675 5:113421607-113421629 TCTGACCCAGATGAGCGAAAGGG - Intronic
997091509 5:130864204-130864226 TGTGCCCTAGATGTGAGACATGG - Intergenic
997456069 5:134018459-134018481 TGTCCCCCAGGTGTGTGATATGG - Intergenic
997944203 5:138184585-138184607 TATCCCCCAGCTTAGAGAAAGGG + Exonic
998003081 5:138639924-138639946 AGTGCCCAGGGTGACAGAAAGGG - Intronic
998165003 5:139837801-139837823 TGGGCCCCAGGTGGGAGTGAAGG - Intronic
999177241 5:149640087-149640109 TGAGCCCCAGGTTTGGGAAATGG + Intergenic
999474757 5:151888390-151888412 TGAGGCCCAGGACAGAGAAAAGG - Intronic
1000087570 5:157901401-157901423 TCTGCTTCAGGAGAGAGAAAGGG - Intergenic
1001776730 5:174334508-174334530 TGTGGCCCTGGTGAGGGAAGTGG - Intergenic
1002379454 5:178815812-178815834 TGGCCAACAGGTGAGAGAAAAGG + Intergenic
1002607877 5:180394010-180394032 TGTGTCCCCGGTGAGGGACAGGG - Intergenic
1002644628 5:180647082-180647104 TGTGACCCAGGTCACAGCAAGGG + Intronic
1003127118 6:3364076-3364098 AGTGCCCCAGGAGAGAGGGAAGG - Intronic
1003229973 6:4243217-4243239 TGTGCCCCAGATGTGAGACATGG - Intergenic
1004305401 6:14497456-14497478 TCTGCCCAAGGTGAGATAAAAGG - Intergenic
1004491610 6:16122568-16122590 TCTGAACCAGGTGAGAGAAGAGG - Intergenic
1005123457 6:22417945-22417967 TGTGGCCCAGGTCAGGGAACAGG - Intergenic
1006873418 6:37274532-37274554 TGTGCCCAAGGTCATGGAAATGG - Intronic
1007387835 6:41531416-41531438 TGCTTCCCAGGTGAGAGAACTGG - Intergenic
1007789526 6:44301143-44301165 GGTGGCCCAGGTGAGGGAAGTGG - Exonic
1010874086 6:81079816-81079838 TGTACCCCAGATTAGAGAGACGG + Intergenic
1012171932 6:96027386-96027408 TGTGCATCAGGGCAGAGAAAGGG - Intronic
1012830858 6:104201949-104201971 TGTGACCCAGATGCGAGACATGG + Intergenic
1013163624 6:107569953-107569975 TGGGCCCCAGTTGAGGGAGAAGG - Intronic
1013607381 6:111762716-111762738 TGTGGCCCAGGGAAGACAAAAGG - Intronic
1013947291 6:115736364-115736386 TGTGACCCAGATGTGAGACATGG + Intergenic
1014154230 6:118092700-118092722 TGTGCCCTGGGTGTGAGACATGG + Intronic
1014327547 6:120018023-120018045 TGTGACCCAGATGCGAGACATGG - Intergenic
1014407061 6:121065082-121065104 TGTGACCCAGATGTGAGACATGG + Intergenic
1014847394 6:126295067-126295089 TGGACCCCAGGTAAGAAAAATGG - Intergenic
1015592891 6:134839338-134839360 TGTGCCACAGGTAAGAGAAATGG + Intergenic
1016281717 6:142426408-142426430 TGTGACCCAGATGTGAGATATGG - Intronic
1016728297 6:147400683-147400705 TGTGCCCTGGGTGTGAGACACGG - Intergenic
1018737979 6:166703305-166703327 TGTGACCCAGGTGTAACAAAAGG - Intronic
1018771750 6:166976855-166976877 AGTGCCCCATGTGGGAGGAAGGG - Intergenic
1021954529 7:25811069-25811091 TGTCTCCCAGGTGTGAGAATTGG + Intergenic
1026136755 7:67670094-67670116 TGTGCCACAGGTGTAAAAAATGG - Intergenic
1026924009 7:74176584-74176606 TGGGTCACAGGTGAAAGAAATGG + Intronic
1027278249 7:76584527-76584549 TGTGTCCCAGGAGAAATAAAGGG + Intergenic
1028530965 7:91838193-91838215 TGTGGTTCAGGTGAGAGAGAAGG - Intronic
1028974505 7:96896731-96896753 TTTGGCTCAGGTGAGAAAAAAGG - Intergenic
1030498223 7:110327024-110327046 TGTGCCCCAGGCTAGAGCATTGG - Intergenic
1032496832 7:132369008-132369030 TGTGCGGCAGGATAGAGAAATGG - Intronic
1032898544 7:136280097-136280119 GGTGCCCCAGGTGACAGAGGGGG - Intergenic
1033321454 7:140343399-140343421 AGTGGGCCAGGTGAGAGAACAGG - Exonic
1034038420 7:147849733-147849755 TGTGGCCTTGGTGACAGAAAGGG - Intronic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1036387685 8:8296189-8296211 TGCACACCAGGTGAAAGAAAGGG - Intergenic
1036496687 8:9276638-9276660 TGTGCACCTGGTGACAGAAAAGG + Intergenic
1036914622 8:12793321-12793343 TGTGCCCCAGATGTGGGACATGG - Intergenic
1037163178 8:15796671-15796693 TTAGCCTCAGGTGACAGAAAGGG + Intergenic
1039224892 8:35377680-35377702 GGTGCCCCAGGTGAGGCAAGGGG + Intronic
1040919387 8:52599626-52599648 TGTGCCCCAGCTGGGAGGAAAGG - Intergenic
1041698920 8:60766273-60766295 TGTGGCTGAAGTGAGAGAAAGGG + Intronic
1042681254 8:71387463-71387485 AGTGGTCCAGGTGAGAGAGACGG + Intergenic
1043074856 8:75685186-75685208 GGTGACGCAGGTGAGAGAAGGGG - Intergenic
1046831523 8:118751642-118751664 TGTGACCTAGGTGTGAGACATGG + Intergenic
1048839419 8:138551810-138551832 TGTGCCCCAGATGTGAGACATGG + Intergenic
1048985051 8:139730734-139730756 GGGGCCCCAGGTCACAGAAATGG + Exonic
1050122493 9:2321700-2321722 TGAGATCCAGGTGAGGGAAAAGG - Intergenic
1050858584 9:10394680-10394702 TGTGCCCCAGATGTCACAAAAGG - Intronic
1052816820 9:33107966-33107988 TGTGCCCCAGAAGAGGAAAAGGG + Intronic
1054739563 9:68791166-68791188 TGTGCCCCAGCAGAGTAAAATGG + Intronic
1055660796 9:78502122-78502144 TGAGCCTCAGGTTGGAGAAATGG + Intergenic
1055856293 9:80691903-80691925 TGTGCCCTAGGTGTGGGACATGG + Intergenic
1056020166 9:82432052-82432074 AGTGCCTCAGGAGATAGAAATGG + Intergenic
1057199313 9:93131880-93131902 TGTGCCCCATTTTACAGAAAAGG + Intronic
1057467689 9:95330556-95330578 GGTGCCCCAGGTGATGGAGAGGG - Intergenic
1057825542 9:98369863-98369885 TGGTACCCTGGTGAGAGAAATGG + Intronic
1057993907 9:99801910-99801932 TGTGTTCCAGGGGAGGGAAATGG - Intergenic
1059304057 9:113340186-113340208 TGAGCCTGAGGTGGGAGAAAGGG - Intronic
1059674962 9:116529251-116529273 TGTGCCCTGGGTGTGAGACATGG + Intronic
1060965402 9:127709750-127709772 TGTTTCCCAGGTGAGAAACAGGG - Intronic
1061506025 9:131032279-131032301 TGTGCCCCAGGGGAGAGGGAGGG + Intronic
1062005732 9:134237607-134237629 AGGGCCCCAGGAGGGAGAAAGGG + Intergenic
1062448472 9:136605522-136605544 TCTGCTCCATGTGAGAGGAAAGG + Intergenic
1186568409 X:10689038-10689060 TGTGCCCCATTTGACAGAATGGG + Intronic
1188079238 X:25815560-25815582 TCAGCCCCAGGGGAGAGAGAGGG - Intergenic
1188106738 X:26156023-26156045 TGTGCCCCAGATGTGAGACGTGG - Intergenic
1189995407 X:46632655-46632677 TTTGCAGCAGGGGAGAGAAACGG - Intronic
1192466171 X:71357833-71357855 TTAGCCCATGGTGAGAGAAAAGG - Intergenic
1193025113 X:76838634-76838656 CGTGCCCTAGGTGTGAGACATGG - Intergenic
1193566954 X:83088566-83088588 TGTGCCCCAGCCTAGAGACAGGG - Intergenic
1193988477 X:88275905-88275927 TGTGCCCCAGAAGTGAGACAAGG + Intergenic
1194742475 X:97590516-97590538 TGTGCTCAAAGTTAGAGAAATGG + Intronic
1194779901 X:98011271-98011293 TGTGACCCAGATGTGAGACATGG + Intergenic
1194925908 X:99823119-99823141 TGTGCACCATGTGAAACAAATGG - Intergenic
1197127504 X:122964790-122964812 TGAGTACTAGGTGAGAGAAAGGG + Intergenic
1197525441 X:127556366-127556388 TGTGCTCCAGGCTAGAGAAGTGG - Intergenic
1198253582 X:134905455-134905477 TTTGTCCCTGGAGAGAGAAATGG + Intronic
1199374572 X:147091737-147091759 TCTGCACCAGGTGATATAAAAGG + Intergenic