ID: 1159251900

View in Genome Browser
Species Human (GRCh38)
Location 18:65890255-65890277
Sequence TGTGCACTCATCAAAATGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159251899_1159251900 27 Left 1159251899 18:65890205-65890227 CCAATATTGTTATAAATTTATGA 0: 1
1: 0
2: 4
3: 48
4: 601
Right 1159251900 18:65890255-65890277 TGTGCACTCATCAAAATGTGTGG 0: 1
1: 0
2: 0
3: 16
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159251900 Original CRISPR TGTGCACTCATCAAAATGTG TGG Exonic
902547804 1:17201005-17201027 TATGCATTCATCAGAATGAGAGG + Intergenic
908127595 1:61046521-61046543 ACTGAACTCATCAAAAGGTGTGG - Intronic
909330948 1:74409819-74409841 TGTGCACATCTCAAATTGTGGGG + Intronic
912120206 1:106462000-106462022 TGTGTAGTCATCACAATGAGAGG + Intergenic
916731837 1:167573492-167573514 TGTGGACTCATTGAAAAGTGAGG - Intergenic
922373800 1:224940359-224940381 ACTCCACTCATCAAAAAGTGGGG - Intronic
923744605 1:236688205-236688227 AGTGCAGTAATCAAAATTTGGGG - Intronic
1063831021 10:9953175-9953197 GGTCCATTCATCAAAATGTGGGG + Intergenic
1063853683 10:10222544-10222566 TGAGCTCTCATTAAAGTGTGTGG - Intergenic
1064600911 10:16991713-16991735 TGTGCGATCATCAAAAAGTCAGG + Intronic
1065720564 10:28625044-28625066 TGTCAAGGCATCAAAATGTGGGG - Intergenic
1067468285 10:46517605-46517627 TGAGCACTCATCAAATTGACAGG + Intergenic
1067541254 10:47155712-47155734 TGTGCACACAACAATATGTGTGG - Intergenic
1071462722 10:85913893-85913915 TGTGTCCTCCTCCAAATGTGAGG - Intronic
1071929973 10:90458088-90458110 TGTGCATTTACCAAAATGAGGGG - Intergenic
1073842001 10:107508444-107508466 TGTGCATGCATCAAAATGTTTGG + Intergenic
1074388613 10:113037525-113037547 TGTGGGCTCATAAAAATATGTGG + Intronic
1074417371 10:113278959-113278981 TGTACACTCATGGAAATATGAGG - Intergenic
1074970122 10:118529259-118529281 TGTGCAATAATCAAATTTTGGGG - Intergenic
1076787103 10:132755976-132755998 TGTGCACACACCAAACAGTGTGG + Intronic
1077782477 11:5346696-5346718 TGTGCACACATCCAAAGCTGTGG + Intronic
1080563386 11:33485016-33485038 TGTGCACCTATCAAAATCAGGGG - Intergenic
1086330393 11:85748146-85748168 TGTACACTTTTCATAATGTGTGG - Intronic
1087112611 11:94487454-94487476 TGTGTACTCTTCAAAATATTAGG + Intronic
1089120046 11:116127340-116127362 TGTGCATGCATGTAAATGTGTGG + Intergenic
1091691547 12:2600776-2600798 TGTTTTCTCATCAAAAGGTGAGG - Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1095299267 12:40563308-40563330 TTTTCTCTCATTAAAATGTGAGG + Intronic
1097590454 12:61567921-61567943 TGTGCACAGATCACAAAGTGAGG - Intergenic
1100151695 12:91745379-91745401 TCTGCTCTCATCTAAATATGAGG + Intergenic
1100745165 12:97637670-97637692 TGTGCACACGACACAATGTGTGG + Intergenic
1101263093 12:103053973-103053995 GGTGCAGTAATCAAACTGTGTGG - Intergenic
1103185366 12:118952323-118952345 TGTGAAGTCATCAGAATTTGAGG + Intergenic
1105654403 13:22420353-22420375 TCTTCCCTCCTCAAAATGTGTGG - Intergenic
1106655202 13:31736145-31736167 TCTGCAGTCTTCAAAATGAGGGG - Intergenic
1107411897 13:40165598-40165620 TGTGCACTCAGCAAAAAGAGAGG + Intergenic
1107805783 13:44152698-44152720 TGTGAGCTCTTCAAAATGTCTGG + Intronic
1107973108 13:45663429-45663451 TGGGCACTCATTAAAAAGTCAGG - Intergenic
1108435799 13:50400568-50400590 TGTGCATCCATCTAACTGTGGGG + Intronic
1108536744 13:51389082-51389104 TTTTGACTCATCAAAATGTCAGG + Intronic
1110512020 13:76361867-76361889 TGTCCCCTCATCAAAAGGTGGGG + Intergenic
1111141801 13:84128248-84128270 TTTGCATTCTTCAAAATGTTAGG - Intergenic
1112218825 13:97465934-97465956 TGTGAAACCAACAAAATGTGGGG - Exonic
1114596424 14:23916129-23916151 TTTCCACTTATCAAAATGTTTGG - Intergenic
1115280832 14:31661226-31661248 TGAGCTCTCATGAAAATATGAGG + Intronic
1119460914 14:74802874-74802896 GGTGTACTTATCAAAATCTGGGG - Intronic
1124531337 15:30510218-30510240 TTGGCACTCACCAAAATCTGTGG - Intergenic
1124767318 15:32497478-32497500 TTGGCACTCACCAAAATCTGTGG + Intergenic
1124890797 15:33731116-33731138 TTTGCAAGCATCAAAATGTTGGG + Intronic
1130930933 15:88427419-88427441 TGTGCAGTCCCCAAGATGTGTGG + Intergenic
1131670668 15:94616367-94616389 TTTCCTCTCATTAAAATGTGGGG - Intergenic
1139250801 16:65493665-65493687 AGTGCACTAATGAAAATGTATGG - Intergenic
1141979315 16:87540218-87540240 TGTGCAGTCAGCAAAAAGCGTGG - Intergenic
1143839283 17:9718941-9718963 TGTGCAATCATGAAAATATAAGG - Intronic
1146249700 17:31327971-31327993 TGTGACCTCATCAAGTTGTGGGG + Intronic
1146923348 17:36728149-36728171 TGTGCATTCATAAAAAAGGGGGG + Intergenic
1147592240 17:41691406-41691428 TGTCCAAACATCAGAATGTGAGG + Exonic
1149772056 17:59330508-59330530 TGTGCAGCCATCAGGATGTGAGG - Intergenic
1153969784 18:10215748-10215770 TGGGGACACATCAAAAGGTGAGG - Intergenic
1159251900 18:65890255-65890277 TGTGCACTCATCAAAATGTGTGG + Exonic
1161185258 19:2914140-2914162 TGTTCTCTCATTAAAAAGTGGGG + Intronic
1161875291 19:6903804-6903826 AGTGCATTCATCAATATCTGTGG - Exonic
1165008959 19:32829276-32829298 TGTGCACTCGTGAAAATGCAGGG + Intronic
1167873418 19:52391928-52391950 TCTCCGGTCATCAAAATGTGTGG + Intergenic
1202632919 1_KI270706v1_random:16488-16510 TGTGCACTCCTCAAAGTTAGTGG - Intergenic
925608154 2:5680019-5680041 TATGCAGCCATCAAAAAGTGAGG - Intergenic
927249946 2:20988488-20988510 TATGCAGGCCTCAAAATGTGGGG - Intergenic
927367317 2:22313891-22313913 TGTGAACTCCAAAAAATGTGTGG + Intergenic
929341698 2:40826744-40826766 TGTGCAATCCTCAAAATTGGTGG + Intergenic
931984155 2:67725517-67725539 TGTGCACTCATGAATTTGGGAGG + Intergenic
935562939 2:104577239-104577261 GGTGCCCTCATCCAAATGTTAGG - Intergenic
937293855 2:120798274-120798296 TGTGTATACATCAAAGTGTGAGG - Intronic
937997189 2:127703113-127703135 TCTGGACTCATCAGAATGTTAGG - Exonic
939115152 2:138052317-138052339 TTTGGACTCATTAAAAAGTGAGG - Intergenic
939595386 2:144116477-144116499 TGTGCACATCTTAAAATGTGGGG + Intronic
940439446 2:153697008-153697030 TGTGAACTCCTGAAAATCTGAGG + Intergenic
942479605 2:176369805-176369827 ACTTAACTCATCAAAATGTGGGG + Intergenic
942940782 2:181613512-181613534 TGTGTACAGATCAAAATCTGAGG + Intronic
943463717 2:188202133-188202155 TGTGCACTCATTAAATTATTTGG - Intergenic
945698353 2:213138057-213138079 TATACACTCATCAAAATATCTGG + Intronic
945982381 2:216323210-216323232 TTTGCAATCATCCAAATGAGTGG + Intronic
946406351 2:219493928-219493950 TGTTCCCTCATCACAATGTGGGG + Intronic
946528812 2:220549320-220549342 TGTCCACTCATCAGATTGTCTGG + Intergenic
948960762 2:241334500-241334522 TGTGAACTCAACAAAGTGAGCGG + Intronic
1168918585 20:1512076-1512098 TGTGCGCTCAGGAATATGTGTGG + Intergenic
1171744280 20:28949654-28949676 TGTGCATTCATCTCACTGTGTGG + Intergenic
1173367028 20:42395521-42395543 TGTTCTCTGATCAAAAGGTGGGG - Intronic
1175197853 20:57257341-57257363 TTTGCAGTCATGAAAATTTGCGG - Intronic
1176476267 21:7213641-7213663 TGTGCATTCATCTCACTGTGTGG - Intergenic
1178290242 21:31361516-31361538 TGTGCACTGTTCTGAATGTGTGG + Intronic
1178368219 21:32005360-32005382 AGTGCCCTTATAAAAATGTGAGG + Intronic
1178668002 21:34565761-34565783 TGTGTGCTCGGCAAAATGTGTGG + Intronic
1178673118 21:34609412-34609434 TGTGCACACATCAGCATGTGTGG - Intronic
1180367812 22:11956866-11956888 TGTGCACTCCTCAAAGTTAGTGG + Intergenic
1180395932 22:12338149-12338171 TGTGCATTCATCTCACTGTGTGG - Intergenic
1180403816 22:12526615-12526637 TGTGCATTCATCTCACTGTGTGG + Intergenic
1181589211 22:23872927-23872949 TGTGAACTCATCAAAATAGTGGG + Intronic
1184504028 22:44890344-44890366 TTTGCGATCATTAAAATGTGTGG - Intronic
949099064 3:121167-121189 TGTGCTTTCATCAAACTGTCAGG + Intergenic
949195995 3:1308260-1308282 TATGCACTCATCAATGTATGGGG + Intronic
950156811 3:10727159-10727181 AGTGCACTCATCAAAATTGCAGG + Intergenic
951925210 3:27901829-27901851 TGTGAACGTCTCAAAATGTGCGG - Intergenic
953215758 3:40916399-40916421 AGTGGCCACATCAAAATGTGAGG + Intergenic
958179212 3:90036007-90036029 TGTGTAATTTTCAAAATGTGTGG - Intergenic
958414336 3:93855843-93855865 TCTGCACTTATCACAATGTTTGG + Intergenic
961802489 3:129462615-129462637 TGTGCACACGTCAAAATGTTTGG + Intronic
962417244 3:135194172-135194194 TGTCCCTTCATCAAAATGTGGGG - Intronic
964430364 3:156599422-156599444 TGTGCACTCACCAAATTGATAGG - Intergenic
964619766 3:158709821-158709843 CCTGCACTCACCAGAATGTGTGG - Intronic
966415821 3:179688371-179688393 TTAGCACTCATCAGAATCTGTGG + Intronic
966448069 3:180025894-180025916 TATGAAGTCATCACAATGTGTGG + Intronic
970746280 4:19299716-19299738 TGTGGAAGAATCAAAATGTGAGG - Intergenic
976381964 4:84409459-84409481 TGGTCACACATCAAAATGTGTGG - Intergenic
978996003 4:115154018-115154040 TGTGCATACTTGAAAATGTGTGG + Intergenic
981641754 4:146952010-146952032 TTTCCATTCATCAAAATGTAGGG - Intergenic
987049439 5:14136876-14136898 TGTGGACTCATTAGAATGTTTGG - Intergenic
990082390 5:51933041-51933063 TCTGAATTCTTCAAAATGTGAGG + Intergenic
990102547 5:52210649-52210671 TGTTAACATATCAAAATGTGTGG - Intergenic
990396840 5:55390789-55390811 TGTACACTTATAAAAATTTGAGG + Intronic
990936310 5:61153897-61153919 TGTACACTCCAGAAAATGTGTGG - Intergenic
991266979 5:64731110-64731132 GGTGCAATCATGGAAATGTGTGG + Intronic
996559557 5:124814309-124814331 TGTGCACCAATCAAAATGGTAGG - Intergenic
997411872 5:133696855-133696877 TGTGAAATCATCAAAGTGTGAGG + Intergenic
998671796 5:144361773-144361795 TGTGTTCTCATCACAATCTGTGG + Intronic
998778500 5:145630103-145630125 TGTGTACTCAAAAAAATGTTTGG + Intronic
999437162 5:151571690-151571712 TGTTCACTCATCTAAACCTGGGG - Intergenic
999631089 5:153572224-153572246 TGGGTACTCATCAAGCTGTGGGG - Intronic
1000455610 5:161445102-161445124 TGTGCACTCCTCAAGATGCTGGG + Intronic
1002642522 5:180636978-180637000 TGTGCACCCAGGAAAATGGGGGG - Intronic
1003311855 6:4975600-4975622 TGTGCACTGAACACAATATGTGG + Intergenic
1004272131 6:14204927-14204949 TGTGTGGTCAGCAAAATGTGGGG + Intergenic
1004287517 6:14335900-14335922 TGTGCCCTCATGGAACTGTGTGG + Intergenic
1004894858 6:20138717-20138739 TGTTAATTCATCAAAAGGTGGGG + Intronic
1009922250 6:70076487-70076509 TGTGTGCTCATCACAATGTGTGG - Intronic
1010602550 6:77848430-77848452 TGGGCACTGATCAAAATGTCAGG - Intronic
1012374419 6:98544248-98544270 TGTGATCTCAGAAAAATGTGTGG + Intergenic
1012928844 6:105295651-105295673 TATGCAATCATGAAAATGTTGGG - Intronic
1013577401 6:111498107-111498129 AGTGCACTCATCAAGGTGAGTGG - Intergenic
1015521370 6:134134873-134134895 TGTGGTCTCATCAAAATGCAAGG + Intergenic
1015898171 6:138036807-138036829 TGTGCTCTAATCAAAAGATGAGG + Intergenic
1017538908 6:155379699-155379721 TCTGCACTCATCAAAATCCAAGG + Intergenic
1017753842 6:157512783-157512805 TGTACACTCATCAGAATGTAGGG + Intronic
1021792687 7:24221960-24221982 TGTGCACTCTTCCATATGTGTGG + Intergenic
1023595999 7:41829949-41829971 TGGGCTCACATCACAATGTGGGG - Intergenic
1029380882 7:100213862-100213884 CGTGCACTCATCAAATTGACAGG + Intronic
1031161117 7:118169808-118169830 TGTACACTCAGAAAGATGTGTGG - Intergenic
1032986259 7:137340838-137340860 TTTGCACTCATCACATTGGGTGG + Intronic
1035883693 8:3269252-3269274 TGGTCAATCATAAAAATGTGCGG + Intronic
1036217363 8:6891875-6891897 TGTGCACTCACCAGCATGGGCGG + Intergenic
1039018216 8:33176657-33176679 TGTGCTCTCATTCATATGTGGGG + Intergenic
1041573723 8:59368994-59369016 TGTGGAATCATAAAAATGTTAGG + Intergenic
1050716793 9:8537731-8537753 TGCAAACTCCTCAAAATGTGAGG - Intronic
1051751713 9:20349858-20349880 TGGGCTCTCATAAAAACGTGGGG - Intronic
1051946970 9:22581080-22581102 TGTGCACTCATAAAATGGTGGGG + Intergenic
1055132220 9:72789011-72789033 TTTACAATCATCAGAATGTGAGG - Intronic
1055507460 9:76963086-76963108 TTGGTACTGATCAAAATGTGCGG - Intergenic
1057885313 9:98825318-98825340 AGTTCTCTCATAAAAATGTGAGG + Intronic
1060909751 9:127340179-127340201 TGTGCACCCATGCACATGTGTGG + Intronic
1203411698 Un_KI270579v1:16327-16349 TGTGCATTCATCTCACTGTGTGG - Intergenic
1188267023 X:28089527-28089549 TGTCCCCACATGAAAATGTGAGG + Intergenic
1190388467 X:49908560-49908582 TCTCCCCTCATCAAAATCTGTGG + Intergenic
1191811636 X:65195961-65195983 TTGGCCCTCATCAAAAAGTGAGG - Intergenic
1193082790 X:77422325-77422347 TGTTCTCCCATCAGAATGTGGGG - Intergenic
1193311960 X:80021161-80021183 TGTGCACAACTCAAAATGTTCGG - Intronic
1195047190 X:101064805-101064827 TGTGCACTTAGCACAGTGTGAGG - Intergenic
1195978469 X:110553313-110553335 AGTGCACTAAACAAAATGGGTGG - Intergenic
1199817184 X:151409189-151409211 TGTATAATCATCAAAATGGGGGG + Exonic
1200919243 Y:8598543-8598565 TGTGCAATTAAGAAAATGTGGGG - Intergenic
1200985185 Y:9296103-9296125 TGTGCAATCAACGGAATGTGGGG + Intergenic
1202125261 Y:21564082-21564104 TGTGCAATCAACGGAATGTGGGG - Intergenic
1202149107 Y:21828805-21828827 TGTGCAATTAAGAAAATGTGGGG - Intergenic
1202153747 Y:21865310-21865332 TGTGCAATCAACGGAATGTGGGG + Intergenic
1202266442 Y:23023485-23023507 TGTGCTCTCAGCTACATGTGAGG + Intergenic
1202419435 Y:24657228-24657250 TGTGCTCTCAGCTACATGTGAGG + Intergenic
1202451351 Y:25012856-25012878 TGTGCTCTCAGCTACATGTGAGG - Intergenic