ID: 1159253396

View in Genome Browser
Species Human (GRCh38)
Location 18:65911417-65911439
Sequence TGCCAATGGCCCATTTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159253396_1159253398 -5 Left 1159253396 18:65911417-65911439 CCAGCAGAAATGGGCCATTGGCA No data
Right 1159253398 18:65911435-65911457 TGGCAAGATTATTTGTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159253396 Original CRISPR TGCCAATGGCCCATTTCTGC TGG (reversed) Intergenic
No off target data available for this crispr