ID: 1159261198

View in Genome Browser
Species Human (GRCh38)
Location 18:66015627-66015649
Sequence CTAGTCCTGCCCTTGACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159261195_1159261198 1 Left 1159261195 18:66015603-66015625 CCCTCATGATTCAGCTATCTTCA No data
Right 1159261198 18:66015627-66015649 CTAGTCCTGCCCTTGACACATGG No data
1159261196_1159261198 0 Left 1159261196 18:66015604-66015626 CCTCATGATTCAGCTATCTTCAC No data
Right 1159261198 18:66015627-66015649 CTAGTCCTGCCCTTGACACATGG No data
1159261194_1159261198 4 Left 1159261194 18:66015600-66015622 CCACCCTCATGATTCAGCTATCT No data
Right 1159261198 18:66015627-66015649 CTAGTCCTGCCCTTGACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159261198 Original CRISPR CTAGTCCTGCCCTTGACACA TGG Intergenic
No off target data available for this crispr