ID: 1159264598

View in Genome Browser
Species Human (GRCh38)
Location 18:66064156-66064178
Sequence TTCTCCGCATATTCAATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159264598_1159264604 28 Left 1159264598 18:66064156-66064178 CCCTAGATTGAATATGCGGAGAA No data
Right 1159264604 18:66064207-66064229 TCTGAGAATAGATGAGAATGAGG No data
1159264598_1159264602 -2 Left 1159264598 18:66064156-66064178 CCCTAGATTGAATATGCGGAGAA No data
Right 1159264602 18:66064177-66064199 AATAAAGATGGGAATTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159264598 Original CRISPR TTCTCCGCATATTCAATCTA GGG (reversed) Intergenic
No off target data available for this crispr