ID: 1159264602

View in Genome Browser
Species Human (GRCh38)
Location 18:66064177-66064199
Sequence AATAAAGATGGGAATTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159264598_1159264602 -2 Left 1159264598 18:66064156-66064178 CCCTAGATTGAATATGCGGAGAA No data
Right 1159264602 18:66064177-66064199 AATAAAGATGGGAATTCCACTGG No data
1159264596_1159264602 8 Left 1159264596 18:66064146-66064168 CCAAATATGTCCCTAGATTGAAT No data
Right 1159264602 18:66064177-66064199 AATAAAGATGGGAATTCCACTGG No data
1159264599_1159264602 -3 Left 1159264599 18:66064157-66064179 CCTAGATTGAATATGCGGAGAAT No data
Right 1159264602 18:66064177-66064199 AATAAAGATGGGAATTCCACTGG No data
1159264595_1159264602 9 Left 1159264595 18:66064145-66064167 CCCAAATATGTCCCTAGATTGAA No data
Right 1159264602 18:66064177-66064199 AATAAAGATGGGAATTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159264602 Original CRISPR AATAAAGATGGGAATTCCAC TGG Intergenic
No off target data available for this crispr