ID: 1159264603

View in Genome Browser
Species Human (GRCh38)
Location 18:66064193-66064215
Sequence ATTCTCAGAAAAATTTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159264603_1159264605 -3 Left 1159264603 18:66064193-66064215 CCACTGGAAATTTTTCTGAGAAT No data
Right 1159264605 18:66064213-66064235 AATAGATGAGAATGAGGTAATGG No data
1159264603_1159264604 -9 Left 1159264603 18:66064193-66064215 CCACTGGAAATTTTTCTGAGAAT No data
Right 1159264604 18:66064207-66064229 TCTGAGAATAGATGAGAATGAGG No data
1159264603_1159264607 4 Left 1159264603 18:66064193-66064215 CCACTGGAAATTTTTCTGAGAAT No data
Right 1159264607 18:66064220-66064242 GAGAATGAGGTAATGGGAAAAGG No data
1159264603_1159264606 -2 Left 1159264603 18:66064193-66064215 CCACTGGAAATTTTTCTGAGAAT No data
Right 1159264606 18:66064214-66064236 ATAGATGAGAATGAGGTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159264603 Original CRISPR ATTCTCAGAAAAATTTCCAG TGG (reversed) Intergenic
No off target data available for this crispr