ID: 1159264604

View in Genome Browser
Species Human (GRCh38)
Location 18:66064207-66064229
Sequence TCTGAGAATAGATGAGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159264598_1159264604 28 Left 1159264598 18:66064156-66064178 CCCTAGATTGAATATGCGGAGAA No data
Right 1159264604 18:66064207-66064229 TCTGAGAATAGATGAGAATGAGG No data
1159264599_1159264604 27 Left 1159264599 18:66064157-66064179 CCTAGATTGAATATGCGGAGAAT No data
Right 1159264604 18:66064207-66064229 TCTGAGAATAGATGAGAATGAGG No data
1159264603_1159264604 -9 Left 1159264603 18:66064193-66064215 CCACTGGAAATTTTTCTGAGAAT No data
Right 1159264604 18:66064207-66064229 TCTGAGAATAGATGAGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159264604 Original CRISPR TCTGAGAATAGATGAGAATG AGG Intergenic
No off target data available for this crispr