ID: 1159266587

View in Genome Browser
Species Human (GRCh38)
Location 18:66088166-66088188
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159266584_1159266587 -6 Left 1159266584 18:66088149-66088171 CCTATATAGTTGGCAGCACTATT No data
Right 1159266587 18:66088166-66088188 ACTATTTAGGGCCTTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159266587 Original CRISPR ACTATTTAGGGCCTTTTTTC AGG Intergenic