ID: 1159272051

View in Genome Browser
Species Human (GRCh38)
Location 18:66165478-66165500
Sequence TAGTGGATATGGAGGCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159272046_1159272051 11 Left 1159272046 18:66165444-66165466 CCCTTTGACTATAGGGGCAAAAC No data
Right 1159272051 18:66165478-66165500 TAGTGGATATGGAGGCCAGAAGG No data
1159272047_1159272051 10 Left 1159272047 18:66165445-66165467 CCTTTGACTATAGGGGCAAAACA No data
Right 1159272051 18:66165478-66165500 TAGTGGATATGGAGGCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159272051 Original CRISPR TAGTGGATATGGAGGCCAGA AGG Intergenic
No off target data available for this crispr