ID: 1159274014

View in Genome Browser
Species Human (GRCh38)
Location 18:66192307-66192329
Sequence ATGAAGCCACAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159274014_1159274019 14 Left 1159274014 18:66192307-66192329 CCTTCCTCCATCTGTGGCTTCAT No data
Right 1159274019 18:66192344-66192366 ACTTCCTTTTGCTTGACTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159274014 Original CRISPR ATGAAGCCACAGATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr