ID: 1159274228

View in Genome Browser
Species Human (GRCh38)
Location 18:66194285-66194307
Sequence GCTCTGAGCAGATCTACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159274228_1159274230 8 Left 1159274228 18:66194285-66194307 CCTTCTGTAGATCTGCTCAGAGC No data
Right 1159274230 18:66194316-66194338 TACTGATACAGTTGATGGTCTGG No data
1159274228_1159274231 19 Left 1159274228 18:66194285-66194307 CCTTCTGTAGATCTGCTCAGAGC No data
Right 1159274231 18:66194327-66194349 TTGATGGTCTGGTCTCTCAGTGG 0: 9
1: 11
2: 23
3: 37
4: 154
1159274228_1159274232 26 Left 1159274228 18:66194285-66194307 CCTTCTGTAGATCTGCTCAGAGC No data
Right 1159274232 18:66194334-66194356 TCTGGTCTCTCAGTGGTAGAAGG No data
1159274228_1159274229 3 Left 1159274228 18:66194285-66194307 CCTTCTGTAGATCTGCTCAGAGC No data
Right 1159274229 18:66194311-66194333 GAGTTTACTGATACAGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159274228 Original CRISPR GCTCTGAGCAGATCTACAGA AGG (reversed) Intergenic
No off target data available for this crispr