ID: 1159284190

View in Genome Browser
Species Human (GRCh38)
Location 18:66327914-66327936
Sequence GTTACTATCTCCAACACCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159284190_1159284192 4 Left 1159284190 18:66327914-66327936 CCAATGGTGTTGGAGATAGTAAC No data
Right 1159284192 18:66327941-66327963 CTTCACCTCTACTCTTTATGAGG No data
1159284190_1159284194 13 Left 1159284190 18:66327914-66327936 CCAATGGTGTTGGAGATAGTAAC No data
Right 1159284194 18:66327950-66327972 TACTCTTTATGAGGTAACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159284190 Original CRISPR GTTACTATCTCCAACACCAT TGG (reversed) Intergenic
No off target data available for this crispr