ID: 1159284191

View in Genome Browser
Species Human (GRCh38)
Location 18:66327936-66327958
Sequence TAAAGAGTAGAGGTGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159284191_1159284194 -9 Left 1159284191 18:66327936-66327958 CCTGACTTCACCTCTACTCTTTA No data
Right 1159284194 18:66327950-66327972 TACTCTTTATGAGGTAACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159284191 Original CRISPR TAAAGAGTAGAGGTGAAGTC AGG (reversed) Intergenic
No off target data available for this crispr