ID: 1159284192

View in Genome Browser
Species Human (GRCh38)
Location 18:66327941-66327963
Sequence CTTCACCTCTACTCTTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159284189_1159284192 12 Left 1159284189 18:66327906-66327928 CCAGGTAGCCAATGGTGTTGGAG No data
Right 1159284192 18:66327941-66327963 CTTCACCTCTACTCTTTATGAGG No data
1159284190_1159284192 4 Left 1159284190 18:66327914-66327936 CCAATGGTGTTGGAGATAGTAAC No data
Right 1159284192 18:66327941-66327963 CTTCACCTCTACTCTTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159284192 Original CRISPR CTTCACCTCTACTCTTTATG AGG Intergenic
No off target data available for this crispr