ID: 1159284194

View in Genome Browser
Species Human (GRCh38)
Location 18:66327950-66327972
Sequence TACTCTTTATGAGGTAACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159284191_1159284194 -9 Left 1159284191 18:66327936-66327958 CCTGACTTCACCTCTACTCTTTA No data
Right 1159284194 18:66327950-66327972 TACTCTTTATGAGGTAACGCTGG No data
1159284190_1159284194 13 Left 1159284190 18:66327914-66327936 CCAATGGTGTTGGAGATAGTAAC No data
Right 1159284194 18:66327950-66327972 TACTCTTTATGAGGTAACGCTGG No data
1159284189_1159284194 21 Left 1159284189 18:66327906-66327928 CCAGGTAGCCAATGGTGTTGGAG No data
Right 1159284194 18:66327950-66327972 TACTCTTTATGAGGTAACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159284194 Original CRISPR TACTCTTTATGAGGTAACGC TGG Intergenic
No off target data available for this crispr