ID: 1159287136

View in Genome Browser
Species Human (GRCh38)
Location 18:66368866-66368888
Sequence GTGGGTGTCAAGATCATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159287133_1159287136 3 Left 1159287133 18:66368840-66368862 CCAGAGGATTAAAAGGTCGACAC No data
Right 1159287136 18:66368866-66368888 GTGGGTGTCAAGATCATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159287136 Original CRISPR GTGGGTGTCAAGATCATTTA AGG Intergenic
No off target data available for this crispr