ID: 1159287349

View in Genome Browser
Species Human (GRCh38)
Location 18:66371872-66371894
Sequence GTGCCTACCCAGATTAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159287349_1159287351 0 Left 1159287349 18:66371872-66371894 CCCAGCTTAATCTGGGTAGGCAC No data
Right 1159287351 18:66371895-66371917 AATCTAATCAGCTACCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159287349 Original CRISPR GTGCCTACCCAGATTAAGCT GGG (reversed) Intergenic
No off target data available for this crispr