ID: 1159287787

View in Genome Browser
Species Human (GRCh38)
Location 18:66375451-66375473
Sequence AGTTATCTGCAGAAGATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159287787_1159287788 4 Left 1159287787 18:66375451-66375473 CCTGCTATCTTCTGCAGATAACT No data
Right 1159287788 18:66375478-66375500 TCTTTTTGAGAGACAGCTCTTGG No data
1159287787_1159287790 16 Left 1159287787 18:66375451-66375473 CCTGCTATCTTCTGCAGATAACT No data
Right 1159287790 18:66375490-66375512 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
1159287787_1159287789 15 Left 1159287787 18:66375451-66375473 CCTGCTATCTTCTGCAGATAACT No data
Right 1159287789 18:66375489-66375511 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
1159287787_1159287792 25 Left 1159287787 18:66375451-66375473 CCTGCTATCTTCTGCAGATAACT No data
Right 1159287792 18:66375499-66375521 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218
1159287787_1159287791 22 Left 1159287787 18:66375451-66375473 CCTGCTATCTTCTGCAGATAACT No data
Right 1159287791 18:66375496-66375518 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159287787 Original CRISPR AGTTATCTGCAGAAGATAGC AGG (reversed) Intergenic
No off target data available for this crispr