ID: 1159287788

View in Genome Browser
Species Human (GRCh38)
Location 18:66375478-66375500
Sequence TCTTTTTGAGAGACAGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159287787_1159287788 4 Left 1159287787 18:66375451-66375473 CCTGCTATCTTCTGCAGATAACT No data
Right 1159287788 18:66375478-66375500 TCTTTTTGAGAGACAGCTCTTGG No data
1159287785_1159287788 27 Left 1159287785 18:66375428-66375450 CCTCTAGGATTTTGGAGCTAGGC No data
Right 1159287788 18:66375478-66375500 TCTTTTTGAGAGACAGCTCTTGG No data
1159287786_1159287788 5 Left 1159287786 18:66375450-66375472 CCCTGCTATCTTCTGCAGATAAC No data
Right 1159287788 18:66375478-66375500 TCTTTTTGAGAGACAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159287788 Original CRISPR TCTTTTTGAGAGACAGCTCT TGG Intergenic
No off target data available for this crispr