ID: 1159289638

View in Genome Browser
Species Human (GRCh38)
Location 18:66399154-66399176
Sequence TAGCATCAGCATTTGTGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159289638_1159289642 22 Left 1159289638 18:66399154-66399176 CCATTACACAAATGCTGATGCTA No data
Right 1159289642 18:66399199-66399221 AGATTGAGAGTAGCCCCAAAAGG No data
1159289638_1159289640 -7 Left 1159289638 18:66399154-66399176 CCATTACACAAATGCTGATGCTA No data
Right 1159289640 18:66399170-66399192 GATGCTATAATTCATCTTGAGGG No data
1159289638_1159289639 -8 Left 1159289638 18:66399154-66399176 CCATTACACAAATGCTGATGCTA No data
Right 1159289639 18:66399169-66399191 TGATGCTATAATTCATCTTGAGG No data
1159289638_1159289641 -1 Left 1159289638 18:66399154-66399176 CCATTACACAAATGCTGATGCTA No data
Right 1159289641 18:66399176-66399198 ATAATTCATCTTGAGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159289638 Original CRISPR TAGCATCAGCATTTGTGTAA TGG (reversed) Intergenic
No off target data available for this crispr