ID: 1159289640

View in Genome Browser
Species Human (GRCh38)
Location 18:66399170-66399192
Sequence GATGCTATAATTCATCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159289638_1159289640 -7 Left 1159289638 18:66399154-66399176 CCATTACACAAATGCTGATGCTA No data
Right 1159289640 18:66399170-66399192 GATGCTATAATTCATCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159289640 Original CRISPR GATGCTATAATTCATCTTGA GGG Intergenic
No off target data available for this crispr