ID: 1159296775

View in Genome Browser
Species Human (GRCh38)
Location 18:66500504-66500526
Sequence CCCGTTCCTGCTATTTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159296769_1159296775 -6 Left 1159296769 18:66500487-66500509 CCCAGTTACTACCCTCTCCCGTT No data
Right 1159296775 18:66500504-66500526 CCCGTTCCTGCTATTTCAGGTGG No data
1159296767_1159296775 21 Left 1159296767 18:66500460-66500482 CCCTGTCAAAAGCTAGGAATGGC No data
Right 1159296775 18:66500504-66500526 CCCGTTCCTGCTATTTCAGGTGG No data
1159296768_1159296775 20 Left 1159296768 18:66500461-66500483 CCTGTCAAAAGCTAGGAATGGCA No data
Right 1159296775 18:66500504-66500526 CCCGTTCCTGCTATTTCAGGTGG No data
1159296770_1159296775 -7 Left 1159296770 18:66500488-66500510 CCAGTTACTACCCTCTCCCGTTC No data
Right 1159296775 18:66500504-66500526 CCCGTTCCTGCTATTTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159296775 Original CRISPR CCCGTTCCTGCTATTTCAGG TGG Intergenic
No off target data available for this crispr